We narrowed to 6,896 results for: sas
-
Plasmid#250518PurposeCell-free translocation reporter; translocation of a nanobody; N-terminal proOmpA-derived signal peptide with and extended hydrophobic core; C-terminal pep86 tagDepositorInsertT7-p(extCore)OAss-nanobody-HiBiT
Tagspep86ExpressionBacterialPromoterT7Available SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTE5603
Plasmid#250511PurposeCell-free membrane insertion reporter; proteorhodopsin (UniProt ID: Q9F7P4; C-terminal transmembrane domain deleted); C-terminal pep104 tagDepositorInsertT7-PR(-1tm)-pep104
Tagspep104ExpressionBacterialPromoterT7Available SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTE5629
Plasmid#250517PurposeCell-free translocation reporter; translocation of a nanobody; N-terminal YncJ signal peptide; C-terminal pep86 tagDepositorInsertT7-pYncJss-nanobody-HiBiT
Tagspep86ExpressionBacterialPromoterT7Available SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
BtA1N
Plasmid#238979PurposeIn vitro transcription of bovine arrestin-1DepositorAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtA2N
Plasmid#238980PurposeIn vitro transcription of bovine arrestin-2 long isoformDepositorAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtARR1 (1-378)
Plasmid#236264PurposeBacterial expression of bovine arrestin-1 (1-378) E379StopDepositorInsertarrestin-1 (SAG Bovine)
ExpressionBacterialMutation(1-378) E379Stop, inserted GGT codon after starti…PromoterlacAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtARR1 R175E
Plasmid#236263PurposeBacterial expression of bovine arrestin-1 R175E with inserted GGT codon after starting ATGDepositorInsertarrestin-1 (SAG Bovine)
ExpressionBacterialMutationR175E, inserted GGT codon after starting ATGPromoterlacAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9-sggfp
Plasmid#236184PurposeThe plasmid pQdCas9-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the gfp gene.DepositorInsertQuorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(A)
Plasmid#236038PurposeThe plasmid pQdCas12a.sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (A) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(B)
Plasmid#236040PurposeThe plasmid pQdCas12a.sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+ dgat1a-FLAG
Plasmid#232143PurposeExpresses zebrafish dgat1a with a C-terminal FLAG tag under control of the CMV promoterDepositorAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRII-TOPO-dgat1b in situ probe
Plasmid#232138Purposezebrafish dgat1b anti-sense in situ probe, linearize with NotI, SP6 polymeraseDepositorInsertdgat1b
UseIn vitro transcriptionPromoterSP6/T7Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuideSLC35C1-neo
Plasmid#220868Purposeencodes CRISPR sgRNA targeting human SLC3C1DepositorInsertSLC35C1 (SLC35C1 Human)
UseLentiviralAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
Plasmid#193050PurposeEncodes guide RNA expression targeting PX740 landing padDepositorInsertGuide RNA
UseCRISPRExpressionWormPromoterU6Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-AB4
Plasmid#185513PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionMutationIDILGE replaced with AAAAAAAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-AB2
Plasmid#185512PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionMutationIDIL replaced with AAAAAAAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-A6
Plasmid#185506PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionMutationFSIENIM to AAAAAAMAvailable SinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2+-wbp2nlY282F
Plasmid#172468Purposeexpresses protein with one aa substitution to affect potential phosphorylation in WW-interaction domainDepositorInsertwbp2nlY282F
UseXenopus expressionTagsnoneMutationchanged Tyrosine at aa282 to PhenylalaninePromoterSP6Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDSARN-vasa-eSpCas9sv40
Plasmid#173670PurposeeSpCas9 expression vector for AnophelesDepositorInserteSpCas9 with Anopheles vasa promoter and SV40 terminator
UseCRISPRExpressionInsectMutationmutations in Cas9 reducing off-target activity (S…PromotervasaAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2+-wbp2nlF127P
Plasmid#174507Purposeexpresses protein with one aa substitution to disrupt the alpha-helix near the PH-G domainDepositorInsertwbp2nlF127P
UseXenopus expressionTagsnoneMutationchanged Phenylalanine at aa127 to ProlinePromoterSP6Available SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only