We narrowed to 14,093 results for: OVA
-
Plasmid#188114PurposeExpresses luciferase under control of Gja1 promoter in transfected cellsDepositorInsertGja1 promoter (Gja1 Mouse)
UseLuciferasePromoterGja1 endogenous promoter up to gene start codonAvailable SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-CV-B3_3C
Plasmid#203499PurposeExpresses CV-B3 3C protease from a GAL promoter with a URA3 markerDepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-LV_3CL
Plasmid#203507PurposeExpresses LV 3CL protease from a GAL promoter with a URA3 markerDepositorInsertLV 3CL protease
ExpressionYeastPromoterGAL1Available SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-SHV_3CL
Plasmid#203473PurposeExpresses SHV 3CL protease from a GAL10 promoter with a URA3 markerDepositorInsertSHV 3CL protease
ExpressionYeastPromoterGAL10Available SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-HHV-3_PR
Plasmid#203505PurposeExpresses protease domain of HHV-3 (VZV) from a GAL promoter with a URA3 markerDepositorInsertHHV-3 protease domain
ExpressionYeastPromoterGAL1Available SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-NWV_3CL
Plasmid#203470PurposeExpresses NWV 3CL protease from a GAL10 promoter with a URA3 markerDepositorInsertNWV 3CL protease
ExpressionYeastPromoterGAL10Available SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-HTLV_PR
Plasmid#203467PurposeExpresses HTLV protease from a GAL10 promoter with a URA3 markerDepositorInsertHTLV protease
ExpressionYeastPromoterGAL10Available SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-PV_3C
Plasmid#203472PurposeExpresses PV 3C protease from a GAL10 promoter with a URA3 markerDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-SV-A_3C
Plasmid#203474PurposeExpresses SV-A 3C protease from a GAL10 promoter with a URA3 markerDepositorAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-1x-HIV-2_PR
Plasmid#201935PurposeExpresses HIV-2 protease from a GAL-1x promoter with a URA3 markerDepositorInsertHIV-2 protease
ExpressionYeastPromoterGAL1Available SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-28a(+)-6xHis-TEV-ORF9c
Plasmid#201023PurposeBacterial expression of codon optimized SARS-CoV-2 ORF9c tagged with an N-terminus His tag followed by a TEV cleavage site.DepositorInsertopen reading frame 9c
Tags6xHis-TEVExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
DNMT2Δ191-237
Plasmid#198382PurposeBacterial expression plasmid for human DNMT2 deletion mutant; for binding assaysDepositorInsertDNMT2 (TRDMT1 Human)
TagsHis-tagExpressionBacterialMutationdeleted amino acids 191-237PromoterT7Available SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Yap1-E1-#2
Plasmid#171519Purposedeletion of a genomic locus in Yap1 geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
piwi_sgRNA
Plasmid#186653Purposepiwi sgRNA plasmidDepositorInsertPiwi sgRNA Plasmid (piwi Fly)
ExpressionInsectAvailable SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-742pUC19-tNGFR-P2A-Caspase8
Plasmid#186099PurposeKnockin of truncated NGFR to target geneDepositorInsertCASPASE8
UseCRISPRMutationWT with tNGFR sequenceAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Nbr_C_sgRNA2
Plasmid#186664PurposeNbr C-tag sgRNA2 plasmidDepositorInsertNbr sgRNA 2 Plasmid (Nbr Fly)
ExpressionInsectAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
Nbr_C_sgRNA1
Plasmid#186663PurposeNbr C-tag sgRNA1 plasmidDepositorInsertNbr sgRNA 1 Plasmid (Nbr Fly)
ExpressionInsectAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only