We narrowed to 10,395 results for: EPO;
-
Plasmid#29077PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceAug. 3, 2011AvailabilityAcademic Institutions and Nonprofits only
-
pNIC-ZB-SPRTN-Y117C-FL
Plasmid#110219PurposeExpression in E. coli of full-length SPRTN protein carrying Y112A mutation, a catalytically impaired mutant, with His and ZB tags at N-terminus.DepositorInsertSPRTN (SPRTN Human)
TagsHis6 and ZBExpressionBacterialMutationY117C, P296L (see depositor comments below)Available SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIS1 ELOVL6
Plasmid#60790PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains ELOVL6 3' UTR and wild-type miR-155 sitesDepositorInsertELOVL6 3'UTR and wild-type miR-155 binding site (ELOVL6 Human)
UseLuciferaseExpressionMammalianPromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pIS1 LPIN1
Plasmid#60802PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains LPIN1 3' UTR and wild-type miR-155 sitesDepositorInsertLPIN1 3'UTR and wild-type miR-155 binding site (LPIN1 Human)
UseLuciferaseExpressionMammalianPromoterthymidine kinase (HSV-TK promoter)Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIS1 PELO
Plasmid#60804PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains PELO 3' UTR and wild-type miR-155 sitesDepositorInsertPELO 3'UTR and wild-type miR-155 binding site (PELO Human)
UseLuciferaseExpressionMammalianPromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMiR-RECK-3'UTR-miR-7-mut
Plasmid#53692PurposeLuciferase reporter assay for RECK 3'UTR that has point mutations on miR-7 binding siteDepositorInsertRECK-3'UTR (RECK Human)
UseLuciferaseMutationnucleotide position 171-174 are mutated to GAAGAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pIS1 EPAS1
Plasmid#60792PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains EPAS1 3' UTR and wild-type miR-155 sitesDepositorInsertEPAS1 3'UTR and wild-type miR-155 binding site (EPAS1 Human)
UseLuciferaseExpressionMammalianPromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV EfIa DIO CaBLAM
Plasmid#244229PurposeCre dependent bioluminescent reporter for calcium signalingDepositorInsertsmNeonGreen
CaBLAM
UseAAVAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pShuttle-CMV-Flag-SREBP-1c
Plasmid#237348PurposeAdenoviral-SREBP-1c cleavage-activation reporter systemDepositorAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(WT)-mascRNA(mut 8356-8370)](pAVA3874)
Plasmid#239353PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of MALAT1 ENE(WT)-mascRNA(mut 8356-8370) reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA(mut 8356-8370)
ExpressionMammalianMutationMALAT1 ENE(WT)-mascRNA(mut 8356-8370: ctacgaccacc…Available SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRAF-V600E-IRES-mCherry
Plasmid#221026PurposeFluorescent reporter for expressing a segment of BRAF-V600E CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.10 promEXOC3
Plasmid#205467PurposeLuciferase reporter of promoter activityDepositorAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-CMV-mCherry-1xU6-LeuIGI2
Plasmid#217368PurposeExpresses E. coli leucine tRNA variant "LeuIGI2" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli leucine tRNA mutant, "LeuIGI2" for TAG suppression
UseAAVExpressionMammalianMutationC2G, C3G, G6U, A7G, U77C, C78G, G81C, G82C, U83CPromoterU6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-Tet-Off_FLEX_Luc-P2A-H2A-mCherry (JDW 970)
Plasmid#229824PurposeA PiggyBac vector with a cre-dependent dual luciferase / nuclear mCherry reporter. In the presence of cre, this tet-off vector will be ubiquitously expressed in the absence of dox/tetDepositorInsertLuciferase-P2A-H2A-mCherry
ExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ GFP-CDK5R1 degron (283-307)-IRES-mCherry
Plasmid#231008PurposeProtein stability reporter construct for CDK5R1 consisting of aa 283-307 for transient overexpression in mammalian cells.DepositorAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-VEGF120-T2A-mCherry
Plasmid#229134PurposeRetrovirus driving overexpression of VEGF120 plus mCherry reporterDepositorAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MYC-GFP-IRES-mCherry
Plasmid#231232PurposeMYC stability reporter construct (expressing c-myc 2) for transient expression in mammalian cells. Stability of GFP-fusion protein can be assed by flow cytometry by normalizing to mCherry expression.DepositorInsertMYC (MYC Human)
ExpressionMammalianAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MCRS1-GFP-IRES-mCherry
Plasmid#231231PurposeMCRS1 stability reporter construct for transient expression in mammalian cells. Stability of GFP-fusion protein can be assed by flow cytometry by normalizing to mCherry expression.DepositorInsertMCRS1 (MCRS1 Human)
ExpressionMammalianAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist-SARS-CoV-2 Spike-deltaC18 FL.1.5.1
Plasmid#212539PurposeEncodes SARS-CoV-2 variant FL1.5.1 Spike for pseudovirus productionDepositorInsertSARS-CoV-2 Spike FL.1.5.1 (S Severe acute respiratory syndrome coronavirus 2)
ExpressionMammalianMutationSee Depositor Comments.PromoterCAGAvailable SinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only