We narrowed to 27,806 results for: gfp
-
Plasmid#59524PurposeN-terminal fusion of EGFP to Drosophila melanogaster Gr21aDepositorAvailable SinceSept. 15, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA4/TO/GFP-GIGYF1
Plasmid#141188PurposeExpresses GFP-GIGYF1 in mammalian cells, can be used to make inducible cell lineDepositorAvailable SinceJune 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
eGFP-proα2(I)-G610C
Plasmid#119827PurposeExpresses mouse Type I procollagen α2 chain (Col1a2) with Gly610Cys mutation and GFP between signal sequence and exon 6DepositorInsertType I procollagen α2 chain (Col1a2 Mouse)
TagseGFPExpressionMammalianMutationCol1a2 exons 2-5 replaced by fluorescent tag, Gly…PromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSIL-eGFP-shACTN1
Plasmid#52676PurposeshRNA against α-actinin-1 with eGFP transfection markerDepositorAvailable SinceJune 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-hGATE-16
Plasmid#87870PurposeExpress a EGFP-human GATE-16 in mammalian cellsDepositorInsertGATE-16 (GABARAPL2 Human)
ExpressionMammalianAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKK-TEV-mEGFP
Plasmid#105794PurposeExpression of your protein of interest in fusion with green fluorescent protein at the C-terminus (cleavable by TEV). mEGFP is an EGFP A206K mutant with reduced dimerization (PMID: 11988576,22869113).DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-mEGFPExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn GFP-Fxr1
Plasmid#112732PurposeAAV plasmid that expresses GFP-Fxr1 fusion protein under hSYN promoterDepositorAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-tetON-shGFP
Plasmid#110939PurposeTet-inducible shRNA targeting GFPDepositorInsertshGFP
UseLentiviral and RNAiPromoterH1/TOAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-PCAF (delta5-53a.a.)
Plasmid#65388PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorInsertPCAF (KAT2B Human)
TagsEmGFP and V5ExpressionMammalianMutationlost 13-159bp of the ORFPromoterCMVAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-GFP (PX458)
Plasmid#129025Purposetargeted DNA demethylation, expression of dCas9-huTET1CD-T2A-EGFP and cloning backbone for sgRNADepositorInsertdCas9-huTET1CD, SgRNA cloning site
TagsHA-Tag, NLS and T2A-EGFPExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FDIO-ArchT-GFP
Plasmid#124640PurposeAAV-mediated FLPo-dependent expression of ArchT-GFP under EF1a promoterDepositorInsertArchT
UseAAV; Flp/frtTagsEGFPExpressionMammalianPromoterEF1aAvailable SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
TfR-moxGFP-DHFR
Plasmid#173012PurposeFor light regulated release of transferrin receptor (TfR) from the endoplasmic reticulum. Driven by CMV promoter. Fused to oxidation resistant version of GFP (moxGFP).DepositorInsertTfR-moxGFP-DHFR
TagsDHFR and moxGFPExpressionMammalianPromoterCMVAvailable SinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-BbsI-CMV-EGFP cloning vector
Plasmid#239464PurposesgRNA cloning vector with EGFP expression cassette. An sgRNA spacer sequence can be cloned into BbsI sites. A CMV-EGFP expression cassette is included as a reporter of transfection efficiency.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 and CMVAvailable SinceDec. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-hUbC-GBX2-CDX124-Cas9-T2A-GFP
Plasmid#192287PurposeExpresses Cas9-T2A-GFP and four sgRNAs: GBX2, CDX1, CDX2, CDX4DepositorInsertUseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBS NL4-3 envFS eGFP PR-D25A
Plasmid#101334PurposepBS NL4-3 envFS eGFP with mutation that disrupts Protease catalytic activityDepositorInsertNL4-3 envFS
UseLentiviralMutationProtease D25AAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-Dub3 mouse
Plasmid#72683Purposemammalian expression of GFP-Dub3DepositorAvailable SinceJuly 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAIP Nup62Fv2GFP
Plasmid#139684PurposeNup62 dimerization construct fused to 2 copies of GFP under an SFFV promoterDepositorInsertNup62 (NUP62 Human)
UseLentiviralTags2 copies of GFP and Dimerization domain FKBPExpressionMammalianPromoterSFFVAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pS24·Pm-GFP
Plasmid#122594PurposeExpresses GFP under the regulatory control of Pm. Expression needs additional xyls geneDepositorInsertPm promoter
UseSynthetic BiologyExpressionBacterialPromoterPmAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW414hrpL-cIgfp
Plasmid#61439PurposepSB4A3 harbouring hrpL-rbs34-cI-lva-ter-Plam-rbs30-gfp-terDepositorInsertHrpL-rbs34-CI-LVA-t-plam-30gfp-t
TagsLVAExpressionBacterialPromoterHrpLAvailable SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only