We narrowed to 5,246 results for: Mos

#112722

Arg47 within TBP6.7 is the most critical residue in terms of forming interactions with WT TAR. Mutating this amino acid to Ala results in ~600-fold reduction in Kd.

Joseph Wedekind

Belashov et al Nucleic Acids Res. 2018 Jul 27;46(13):64

Aug. 8, 2018

Academic Institutions and Nonprofits only

#66013

MoClo Basic Part: Controllable promoter - pLuxR(pR) - luxR regulated (right promoter, weak constitutive down regulated by LuxR, C0062 in combination with homoserine lactone (HSL)) [E:R0063:B]

Douglas Densmore

Iverson et al ACS Synth Biol. 2016 Jan 15;5(1):99-103.

Jan. 21, 2016

Academic Institutions and Nonprofits only

#66014

MoClo Basic Part: Controllable promoter - pLuxR(pR) - luxR regulated (right promoter, weak constitutive down regulated by LuxR, C0062 in combination with homoserine lactone (HSL)) [F:R0063:B]

Douglas Densmore

Iverson et al ACS Synth Biol. 2016 Jan 15;5(1):99-103.

Jan. 21, 2016

Academic Institutions and Nonprofits only

#66015

MoClo Basic Part: Controllable promoter - pLuxR(pR) - luxR regulated (right promoter, weak constitutive down regulated by LuxR, C0062 in combination with homoserine lactone (HSL)) [G:R0063:B]

Douglas Densmore

Iverson et al ACS Synth Biol. 2016 Jan 15;5(1):99-103.

Jan. 21, 2016

Academic Institutions and Nonprofits only

#65846

Mammalian expression of the mutated N terminal part (R5A-K5A N23, transmembrane part of 23 aa) of C11orf83/UQCC3 fused to GFP protein (C-ter)

Amos Bairoch

Desmurs et al Mol Cell Biol. 2015 Apr;35(7):1139-56. d

July 7, 2015

Academic Institutions and Nonprofits only

#65847

Mammalian expression of the mutated N terminal part (R5D-K5D N23, transmembrane part of 23 aa) of C11orf83/UQCC3 fused to GFP protein (C-ter)

Amos Bairoch

Desmurs et al Mol Cell Biol. 2015 Apr;35(7):1139-56. d

July 7, 2015

Academic Institutions and Nonprofits only

#87382

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#110544

rhaBAD, a rhamnose-inducible promoter, YFP, an E. coli-Synechocystis shuttle vector, chromosomal-integration sites. Allows precise & sustained gene expression in cyanobacteria.

John Heap

Kelly et al ACS Synth Biol. 2018 Apr 2. doi: 10.1021

June 6, 2018

Academic Institutions and Nonprofits only

#196328

35S promoter-driven expression of the tobacco etch virus P1/HC-Pro RNA silencing suppressor

Zhenghe Li

Ganesan et al J Virol. 2013 Oct;87(19):10598-611. doi:

May 3, 2023

Academic Institutions and Nonprofits only