We narrowed to 17,417 results for: mal.2
-
Plasmid#164102PurposeFluorescent reporter for genetic tracing of mesenchymal Glioblastoma cell-state.DepositorInsertMGT#2-mCherry
UseLentiviral and Synthetic BiologyAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shID2 #2
Plasmid#83087PurposeLentiviral shRNA vector for inducible knockdown of human ID2DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 2 CMV mTFP1 Actin
Plasmid#206255PurposeENTR Vector 2 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes mTFP1 Actin under the control of CMV promoter.DepositorInsertmTFP1 Actin
UseMultimate/gateway entr 2TagsmTFP1ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-let-7a-2-3p
Plasmid#103144PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7a-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7a-2-3p target (MIRLET7A2 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-26a-2-3p
Plasmid#103378PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-26a-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-26a-2-3p target (MIR26A2 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-let-7f-2-3p
Plasmid#103155PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7f-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7f-2-3p target (MIRLET7F2 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-SARS-CoV-2-S-ectodomain
Plasmid#235984PurposeInternally tagged SARS-CoV-2 spike ecto-domainDepositorInsertSpike protein (S SARS-CoV-2)
Tags8xHis and Twin-Strep tag and internal Twin-Strep …ExpressionMammalianMutationaa 1-1208, D614G, RRAR684-684GSAS, and DK987-987P…PromoterCMVAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ZNF398_5-2)-PGKpuroBFP-W
Plasmid#211998PurposeExpress gRNA against ZNF398 with puro and BFPDepositorInsertsgRNA targeting ZNF398 (ZNF398 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(AAVS1-2)-PGKpuroBFP-W
Plasmid#211955PurposeExpress safe-cutter control gRNA with puro and BFPDepositorInsertsafe-cutter control sgRNA_AAVS1-2 (AAVS1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 NKX6-2(1-188)-Venus
Plasmid#203714PurposeSPAX8-related truncated mutation (E189*) containing the amino acids 1 to 188 of human NKX6-2 fused with the Venus fluorescent proteinDepositorInsertNKX6-2 (1-188) fused with Venus (NKX6-2 Human)
TagsVenusExpressionMammalianMutationdeletion of amino acids 189-277PromoterCMVAvailable SinceSept. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 NKX6-2(1-40)-Venus
Plasmid#203713PurposeSPAX8-related truncated mutation (K41*) containing the amino acids 1 to 40 of human NKX6-2, fused with the Venus fluorescent protein.DepositorInsertNKX6-2 (1-40) fused with Venus (NKX6-2 Human)
TagsVenusExpressionMammalianMutationdeletion of amino acids 41-277PromoterCMVAvailable SinceSept. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFDPS #2
Plasmid#198760Purposeconditional knockdown of FDPSDepositorInsertshFDPS #2 (FDPS Human)
ExpressionMammalianAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-30c-2-3p
Plasmid#103414PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-30c-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-30c-2-3p target (MIR30C2 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-92a-2-5p
Plasmid#103751PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-92a-2-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-92a-2-5p target (MIR92A2 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-450a-2-3p
Plasmid#103532PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-450a-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-450a-2-3p target (MIR450A2 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-19b-2-5p
Plasmid#103326PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-19b-2-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-19b-2-5p target (MIR19B2 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-16-2-3p
Plasmid#103271PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-16-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-16-2-3p target (MIR16-2 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-129-2-3p
Plasmid#103206PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-129-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-129-2-3p target (MIR129-2 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-103a-2-5p
Plasmid#103167PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-103a-2-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-103a-2-5p target (MIR103A2 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only