We narrowed to 25,249 results for: promoter
-
Plasmid#251686PurposegRNA to knock out ETS1 in mammalian cellsDepositorInsertETS1 ETS proto-oncogene 1, transcription factor (ETS1 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-Nppa-Cre
Plasmid#247326PurposeExpresses Cre recombinase under the control of the Nppa Promoter.DepositorInsertNppa-Cre
UseAAVExpressionMammalianMutationTagRFP is out of frame and therefore not translat…PromoterNppa Proximal promoterAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-TRIP12-HECT
Plasmid#241818PurposeExpesses GST-TRIP12 for protein purificationDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
sh2g-ZMYND8-human
Plasmid#201406PurposeKnockdown of Zinc Finger MYND Type-8. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertZMYND8 (ZMYND8 Human)
ExpressionMammalianAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau10-12K317M
Plasmid#194164PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by tau cDNA exons 10-12 with FTLD-Tau K317M mutation. Expresses the tau circRNA 12-->10 K317M with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 WT (MAPT Human)
Tags3X FlagExpressionMammalianMutationChanged Lysine 317 to MethionineAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
IL2-AHA740D, E758K-2A-Cherry-RhoAQ63L in pmCherryN1
Plasmid#187288PurposeExpress pmCherry-IL2-AH A740D, E758K-2A-RhoA Q63LDepositorTagsmCherryExpressionMammalianMutationAH A740D, E758K, RhoA Q63LPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(SCA)-BPNLS(SV40)-P2A-EGFP (LTH1378)
Plasmid#185484PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(SCA) with an N-terminal NLS, C-terminal bi-partite NLS, and P2A-eGFPDepositorInserthuman codon usage NLS-anCas(SCA)-BPNLS-P2A-eGFP
UseIn vitro transcription; t7 promoterTagsBPNLS-P2A-eGFP and NLSExpressionMammalianPromoterCMV and T7Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(PCA)-BPNLS(SV40)-P2A-EGFP (LTH1441)
Plasmid#185486PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PCA) with an N-terminal NLS, C-terminal bi-partite NLS, and P2A-eGFPDepositorInserthuman codon usage NLS-anCas(PCA)-BPNLS-P2A-eGFP
UseIn vitro transcription; t7 promoterTagsBPNLS-P2A-eGFP and NLSExpressionMammalianPromoterCMV and T7Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(FCA)-BPNLS(SV40)-P2A-EGFP (LTH1380)
Plasmid#185487PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(FCA) with an N-terminal NLS, C-terminal bi-partite NLS, and P2A-eGFPDepositorInserthuman codon usage NLS-anCas(FCA)-BPNLS-P2A-eGFP
UseIn vitro transcription; t7 promoterTagsBPNLS-P2A-eGFP and NLSExpressionMammalianPromoterCMV and T7Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-nSpCas9(D10A)-BPNLS(SV40)-3xFLAG-P2A-EGFP (HES24)
Plasmid#185492PurposeCMV and T7 promoter expression plasmid for human codon usage nSpCas9(D10A) with a C-terminal bi-partite NLS, 3x FLAG, and P2A-eGFPDepositorInserthuman codon usage nSpCas9(D10A)-BPNLS-P2A-eGFP
UseIn vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-eGFPExpressionMammalianMutationD10APromoterCMV and T7Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
SITS-Cavin4b-EGFP
Plasmid#176019PurposeLeishmania cell free expression of zebrafish Cavin4b-EGFP. Parton lab clone GRJDepositorInsertCavin4b (cavin4b Zebrafish)
UseLeishmania cell free expressionAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
SITS-Cavin4b-mCherry
Plasmid#176023PurposeLeishmania cell free expression of zebrafish Cavin4b-mCherry. Parton lab clone GWRDepositorAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cavin4b-mCherry
Plasmid#176008PurposeMammalian expression of zebrafish Cavin4b-mCherry. Parton lab clone HYODepositorAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cavin4b(PRDmt)-mCherry
Plasmid#176009PurposeMammalian expression of zebrafish Cavin4b(PRDmt)-mCherry. Parton lab clone JMDDepositorAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cavin4b-EGFP
Plasmid#176011PurposeMammalian expression of zebrafish Cavin4b-EGFP. Parton lab clone HXMDepositorAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pME-Cavin4b_PRDmt
Plasmid#176017PurposeMultisite gateway middle entry clone containing zebrafish Cavin4b_PRDmt with no stop codon. Parton lab clone JLY.DepositorInsertCavin4b (PRDmt) (cavin4b Zebrafish)
UseGateway entry cloneAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cavin4b in pBluescript(SK+)
Plasmid#126566PurposeFor generating RNA probes for in situ hybridisation. Parton lab clone IRZDepositorInsertCavin4b (cavin4b Zebrafish)
UseGateway entry cloneAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
p3E-BIN1_tv8
Plasmid#126574PurposeMultisite gateway middle entry vector containing human BIN1 transcriptional variant 8 (muscle specific) with no ATG. Parton lab clone DVA.DepositorInsertBIN1 (BIN1 Human)
UseGateway entry cloneAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
Pet22b-mEGFP-YAP-C-IDR
Plasmid#166441PurposeBacterial expression of 6x His tagged mEGFP-YAP1-C-IDR fusion proteinDepositorInsertmEGFP, YAP-C-IDR(266-504) (YAP1 Human)
ExpressionBacterialAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only