We narrowed to 13,693 results for: crispr cas9
-
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCG-scr
Plasmid#229847PurposeExpresses wild-type Cas9 and scrambled gRNA.DepositorInsertguide RNA with scrambled sequence
UseCRISPRExpressionMammalianAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
HCP1
Plasmid#166103PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombination.DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
Pdpy-30-miniCAFE
Plasmid#170115PurposeDpy-30 promoter-driven expression of a truncated VPR-dCjCas9 fusion protein (MiniCAFE) for activation of gene expression.DepositorInsertMiniCAFE
UseCRISPRMutationD8A, HNH-truncation (Δ495–609 aa) in CjCas9PromoterDpy-30Available SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
PL-5LTR-RGR(DMD#1)-AmCyan-A
Plasmid#138482PurposeExpresses sgRNA targeting human DMD (Dystrophin) for packaging into NanoMEDIC particle.DepositorInsertRibozyme-flanked gRNA and AmCyan
UseCRISPRExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
plenti-Lb-Cas12a-2xNLS
Plasmid#155046PurposeLentiviral vector expressing human codon-optimized _C-terminal Myc-tagged Lachnospiraceae bacterium (Lb)-Cas12a nuclease with N- and C-terminal NLS and Neomycin/G418/Geneticin resistance from EF-1alpha promoterDepositorInsertLbCas12a
UseCRISPR and LentiviralTagsNucleoplasmin NLS, Myc-tag and SV40 NLSExpressionMammalianPromoterEF-1aAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
plenti-As-Cas12a-2xNLS
Plasmid#155047PurposeLentiviral vector expressing human codon-optimized _C-terminal Myc-tagged _Acidaminococcus sp. BV3L6 (As)-Cas12a nuclease with N- and C-terminal NLS and Neomycin/G418/Geneticin resistance from EF-1alpha promoterDepositorInsertAsCas12a
UseCRISPR and LentiviralTagsNucleoplasmin NLS, Myc-tag and SV40 NLSExpressionMammalianPromoterEF-1aAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
B2M Bulldozer (gRNA crB2M_13)
Plasmid#84381PurposeThis plasmid expresses a gRNA targeting the first exon of human B2M. Most efficient gRNA targeting B2M, leading to ablation of B2M and MHC class I surface expression in 50% of transfected cellsDepositorInsertB2M Bulldozer crB2M_13 gRNA
ExpressionMammalianPromoterhU6 promoterAvailable SinceJuly 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97308PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only