We narrowed to 22,688 results for: AGA

#107543

AAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFP

Hélène Marie

Pousinha et al Elife. 2017 Jul 6;6. doi: 10.7554/eLife.

May 1, 2018

Academic Institutions and Nonprofits only

#172625

Retroviral vector for the constitutive expression of FLAG-2xSTREP-tagged cyclin D2(T280A) and a puromycin resistance marker in mammalian cells

Michele Pagano

Simoneschi et al Nature. 2021 Apr;592(7856):789-793. doi:

Aug. 20, 2021

Academic Institutions and Nonprofits only

#172643

Retroviral vector for the constitutive expression of FLAG-2xSTREP-tagged cyclin D1 and a puromycin resistance marker in mammalian cells

Michele Pagano

Simoneschi et al Nature. 2021 Apr;592(7856):789-793. doi:

Aug. 20, 2021

Academic Institutions and Nonprofits only

#113156

An AAV vector that expresses guide RNAs targeting rat Rosa26 and expresses EGFP reporter

Brandon Harvey

Back et al Neuron. 2019 Feb 8. pii: S0896-6273(19)3

March 7, 2019

Academic Institutions and Nonprofits only

#208344

pLentiCRISPRv2-Blast backbone with two separate sgRNAs against CDK12

Peter S Nelson

Frank et al eLife 2025

Jan. 29, 2026

Academic Institutions and Nonprofits only

#233344

Stable expression of EGFP-LOV2(N538E)-BAX(G108V)-Cyb5a in mammalian cells. The G108V mutation suppresses pore-forming activity of BAX.

Noboru Mizushima

Nagashima et al J Biol Chem. 2025 Mar 18;301(4):108421.

June 5, 2025

Academic Institutions and Nonprofits only

#233345

Stable expression of EGFP-LOV2(G528A, N538E)-BAX-TMEM106B in mammalian cells. The G108V mutation suppresses pore-forming activity of BAX.

Noboru Mizushima

Nagashima et al J Biol Chem. 2025 Mar 18;301(4):108421.

April 28, 2025

Academic Institutions and Nonprofits only

#227438

An AAV backbone for expression of the G-PTEN sensor under the CAG promoter, in a Cre dependent manner.

Tal Laviv

Kagan et al Nat Methods. 2025 Apr;22(4):764-777. doi

April 23, 2025

Academic Institutions and Nonprofits only

#232274

Expression of N-terminal tagged 2xFLAG-2xSTREP-BACH1 (H. sapiens) with Cys122 to Glu point mutation in human cell lines

Michele Pagano

Cao et al Cell. 2024 Oct 30:S0092-8674(24)01188-7.

Feb. 20, 2025

Academic Institutions and Nonprofits only

#224741

Retroviral vector for delivery and expression of acGFP1-tagged GTSE1 protein with S91, 262, 454, 724A mutation

Michele Pagano

Garcia-Vazquez et al bioRxiv [Preprint]. 2025 Jan 23:2024.06.

Dec. 23, 2024

Academic Institutions and Nonprofits only