We narrowed to 14,331 results for: cas9 genes
-
Plasmid#126900PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ PLDbeta1
Plasmid#126902PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Dja6_1
Plasmid#126894PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pML104-KanMx4
Plasmid#83476PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains KanMx4 marker for yeast transformation.DepositorInsertKanMX4
ExpressionYeastAvailable SinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA098
Plasmid#245320PurposeCas9 CRISPRko all-in-one positive control; targets CD47DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-MBP-Geo_st
Plasmid#87700PurposeExpression plasmid for Cas9 from Geobacillus stearothermophilus with an N-Term MBPDepositorInsertGeoCas9
Tags10xHis-MBP-TEVExpressionBacterialAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4
Plasmid#83475PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains HphMx4 marker for yeast transformation.DepositorInsertHphMX4
ExpressionYeastAvailable SinceOct. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pML104-NatMx3
Plasmid#83477PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains NatMX3 marker for yeast transformation.DepositorInsertNatMx3
ExpressionYeastAvailable SinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA103
Plasmid#245325PurposeCas9 CRISPRa positive control guide; targets CD47DepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRDB_512
Plasmid#245338PurposeCas9 ABE & CBE positive control guide; targets CD47DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA102
Plasmid#245324PurposeCas9 CRISPRa positive control guide; targets CD47DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLIII CKBs CRISPR with guides at 1-2 and 2-3
Plasmid#238525PurposePlant expression of Cas9 and gRNAs against A. thaliana CK2alpha3DepositorAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
HCP2
Plasmid#166104PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombinationDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP3
Plasmid#166105PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombinationDepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP7
Plasmid#166109PurposeThis plasmid encodes a Cas9 protein as well as two sgRNAs, one targets the C-terminus of Whi5 and the other targets the C-terminus of Hta2.DepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRARB.1.0-gDNA
Plasmid#132471PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertRARB (RARB Human)
UseCRISPRAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
UCT1m
Plasmid#121041PurposeMoClo golden gate assembly DE part for gQi gRNA (guide RNA for S. pyogenes Cas9; sequence from DOI: 10.1016/j.cell.2013.02.022). Please see Supplemental Documents for annotated Genbank file.DepositorInsertUCT-part guide RNA (Stanley Qi sequence)
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF3_1
Plasmid#72363PurposeEncodes gRNA for 3' target of human ZNF3 along with Cas9 with 2A GFPDepositorInsertZNF3 (ZNF3 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF3_2
Plasmid#72364PurposeEncodes gRNA for 3' target of human ZNF3 along with Cas9 with 2A GFPDepositorInsertZNF3 (ZNF3 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only