We narrowed to 11,299 results for: cat.1
-
Plasmid#116889PurposeExpresses HA-tagged human dominant-negative 14-3-3 zeta (R56A/R60A) in mammalian cellsDepositorAvailable SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
NFATc1_L (OZ543)
Plasmid#28068DepositorInsertZinc finger array targeting NFATc1 (nfatc1 Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
NFATc1_R (OZ544)
Plasmid#28069DepositorInsertZinc finger array targeting NFATc1 (nfatc1 Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
LacZ in pLX304
Plasmid#42560DepositorInsertLacZ
UseLentiviralTags2xV5PromoterCMVAvailable SinceMarch 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
p6599 MSCV-IP N-HAonly FOSL1
Plasmid#34897DepositorAvailable SinceFeb. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGL3-OT (wt TCF-4 sites)
Plasmid#16558DepositorInsertTCF-4 binding sites (TCF4 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutation3 copies of wildtype Tcf-4 binding sitesAvailable SinceMarch 28, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGL3-OF (mutant TCF-4 sites)
Plasmid#16559DepositorInsertTCF-4 binding sites (TCF4 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutation3 copies of mutant Tcf-4 binding sitesAvailable SinceMarch 28, 2008AvailabilityAcademic Institutions and Nonprofits only -
pet23a_RBPMS_1_101
Plasmid#65728Purposeplasmid for bacterial overexpression of RBPMSDepositorInsertRBPMS (RBPMS Human)
TagsHis TagExpressionBacterialMutationdeletion construct encoding amino acids 1-101PromoterT7Available SinceAug. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pet28a_RBPMS_1_129
Plasmid#65738Purposeplasmid for bacterial overexpression of RBPMSDepositorInsertRBPMS (RBPMS Human)
TagsHis TagExpressionBacterialMutationdeletion construct encoding amino acids 1-129PromoterT7Available SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pet28a_RBPMS_1_100
Plasmid#65735Purposeplasmid for bacterial overexpression of RBPMSDepositorInsertRBPMS (RBPMS Human)
TagsHis TagExpressionBacterialMutationdeletion construct encoding amino acids 1-100PromoterT7Available SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pet23a_RBPMS_1_120
Plasmid#65730Purposeplasmid for bacterial overexpression of RBPMSDepositorInsertRBPMS (RBPMS Human)
TagsHis TagExpressionBacterialMutationdeletion construct encoding amino acids 1-120PromoterT7Available SinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYihI-N+C-term K-R
Plasmid#233093PurposeExpression of GST-YihI with N+C-term lysines (K) mutated to arginine (R)DepositorInsertGST-YihI with N+C-term lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationGST-YihI with N+C-term lysines (K) mutated to arg…Available SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term K-R
Plasmid#233091PurposeExpression of GST-YihI with N-term lysines (K) mutated to arginine (R)DepositorInsertYihI with N-term lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationN-terminal lysine residues mutated to arginineAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-All K-R
Plasmid#233094PurposeExpression of GST-YihI with all lysines (K) mutated to arginine (R)DepositorInsertGST-YihI with all lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationGST-YihI with all lysines (K) mutated to arginine…Available SinceMay 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGEMHE:hTRAAK(Q258K)
Plasmid#224763PurposeIn vitro transcription for Oocyte expression of hTRAAK(Q258K)DepositorInsertPotassium channel subfamily member 4 (KCNK4 Human)
UseIn vitro transcription for oocyte expressionMutationQ258KPromoterT7Available SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE:hTRAAK(S118C)
Plasmid#224762PurposeIn vitro transcription for Oocyte expression of hTRAAK(S118C)DepositorInsertPotassium channel subfamily member 4 (KCNK4 Human)
UseIn vitro transcription for oocyte expressionMutationS118CPromoterT7Available SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-ZGLP1
Plasmid#222926PurposePiggyBac transposon plasmid for doxycycline inducible expression of ZGLP1DepositorInsertZGLP1 (ZGLP1 Human)
ExpressionMammalianAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FRISZ-GPI
Plasmid#177264PurposeAAV transfer plasmid for cell-surface-localized FRISZ (via CD59 GPI) under hSyn promoterDepositorInsertCD59 leader-FRISZ-GPI
UseAAVTagsCD59 GPI and CD59 leader sequencePromoterhSynAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pet28a_RBPMS_1_120
Plasmid#65737Purposeplasmid for bacterial overexpression of RBPMSDepositorInsertRBPMS (RBPMS Human)
TagsHis TagExpressionBacterialMutationdeletion construct encoding amino acids 1-120PromoterT7Available SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only