261,172 results
-
-
pmGFP-ADAR1-p150
Plasmid#117927PurposeADAR1-p150 expression plasmid.DepositorAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmGFP-ADAR1-p150
Plasmid#117927PurposeADAR1-p150 expression plasmid.DepositorAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYFAC-ubi-Y-pyrG
Plasmid#184497PurposeAMA1 based vector for optimised episomal expression in filamentous fungi, with increased selection stringency using the modified ubi-Y-pyrG marker (high stringency).DepositorTypeEmpty backboneUseSynthetic Biology; Expression in aspergillus and …Available SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-TREG3G-PE2-rtTA3G-P2A-eGFP
Plasmid#196971PurposePiggybac vector with doxycyclin-inducible prime editor for mammalian cellsDepositorInsertsCas9-RT
rtTA3G-P2A-eGFP
ExpressionMammalianPromoterPGK and TREG3GAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…Available SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…Available SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHCMV-LCMV-WE
Plasmid#15793DepositorInsertLymphocytic choriomeningitis virus glycoprotein LCMVGP gene
ExpressionMammalianAvailable SinceMarch 21, 2008AvailabilityAcademic Institutions and Nonprofits only -
pHCMV-LCMV-WE
Plasmid#15793DepositorInsertLymphocytic choriomeningitis virus glycoprotein LCMVGP gene
ExpressionMammalianAvailable SinceMarch 21, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GFP-Fishell-1 (AAV9)
Viral Prep#83900-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-mDlx-GFP-Fishell-1 (#83900). In addition to the viral particles, you will also receive purified pAAV-mDlx-GFP-Fishell-1 plasmid DNA. mDlx-driven expression of GFP in GABA-ergic interneurons. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxTagsGFPAvailable SinceNov. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-FLEX-jGCaMP8s-WPRE (AAV9)
Viral Prep#162380-AAV9PurposeReady-to-use AAV9 particles produced from pGP-AAV-CAG-FLEX-jGCaMP8s-WPRE (#162380). In addition to the viral particles, you will also receive purified pGP-AAV-CAG-FLEX-jGCaMP8s-WPRE plasmid DNA. CAG-driven, Cre-dependent expression of calcium sensor GCaMP8s (more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/HF-CDC50A
Plasmid#209223PurposeMammalian expression of CDC50ADepositorAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDM068
Plasmid#216811PurposeVector for Aspergillus CRISPR-Cas9 genetic engineering with Golden Gate cloning drop-out cassette for protospacer insertion and NAT selectable marker.DepositorTypeEmpty backboneUseCRISPR; Fungal expressionExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
M13-kmR
Plasmid#206861PurposeM13KE from NEB modified with kanamycin resistance gene and NotI restriction site on g3p ( M13KE-NotI-Kan)DepositorInsertKanamycin resistance gene
ExpressionBacterialPromoterlacAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLCS107
Plasmid#209328PurposeGateway cloning compatible vector for transient expression in protoplasts. Arabidopsis UBQ10 promoter for N-terminal mNeonGreen fusion protein.DepositorTypeEmpty backboneExpressionPlantAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC30A7_STOP
Plasmid#161314PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC30A7 (SLC30A7 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA_mIGg2a_Anti-HA [12CA5] v2
Plasmid#236295PurposeMammalian vector expressing Anti-HA [12CA5] variable region fused to mouse IgG2a heavy chain; to be used with pcDNA_mK_Anti-HA [12CA5] v2 light chain (Plasmid 236296) to make the antibody.DepositorInsertAnti-HA [12CA5] heavy chain variable region fused to mouse IgG2a heavy chain
TagsMouse IgG2a FcExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA_mK_Anti-HA [12CA5] v2
Plasmid#236296PurposeMammalian vector expressing Anti-HA [12CA5] variable region fused to mouse Kappa light chain; to be used with pcDNA_mIGg2a_Anti-HA [12CA5] v2 heavy chain (Plasmid 236295) to make the antibody.DepositorInsertAnti-HA [12CA5] light chain variable region fused to mouse kappa light chain
ExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSFFV_mNG3A(1-10)
Plasmid#157992PurposeLentiviral vector of constitutive expression of mNeonGreen3A(1-10)DepositorInsertpSFFV_mNG3K(1-10)
UseLentiviralExpressionMammalianMutationW148L, M150V, K153M, N194K, F204LPromoterSFFVAvailable SinceOct. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_NE1m (AAV9)
Viral Prep#123308-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_NE1m (#123308). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_NE1m plasmid DNA. Synapsin-driven expression of GRAB-NE1m norepinephrine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only