We narrowed to 10,501 results for: yeast
-
Plasmid#177286Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmR and eYFPDepositorInserteYFP
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW13K_3G5
Plasmid#177287Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmR and mCherryDepositorInsertmCherry
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW18K_3T5
Plasmid#177288Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with TcR and mCherryDepositorInsertmCherry
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW20K_0Ti1
Plasmid#177289Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon with TcRDepositorInsertPtet-tetA(C)
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW28K_0Ti1
Plasmid#177290Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon/SacB with TcRDepositorInsertPsacB-sacB
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-STE3pr-MFA-Igkappa-FAPoptim-STE3-K424R
Plasmid#221119PurposeFAP tagged STE3-K424R mutant (N-terminally tagged, optimized) under the Ste3 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3-K424R
ExpressionYeastMutationSTE3 mutantK424RPromoterSTE3Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00045
Plasmid#232904PurposePlasmid carrying MSN5 from LY00045 (S288C) with its native promoter and terminator.DepositorInsertMSN5 (MSN5 Budding Yeast)
ExpressionYeastAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC-His+Strep-Opa1 (SB254)
Plasmid#227603PurposeInducible coexpression of His-tagged SLC25A46 and Strep-tagged Opa1 in Pichia pastorisDepositorInsertsTags10xHis and Twin-StrepTagExpressionYeastMutationcontains aa 253-960 onlyPromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC25A46[∆2-83]-His (SB258)
Plasmid#227607PurposeInducible expression of His-tagged SLC25A46 lacking its N-terminal region (∆2-83) in Pichia pastorisDepositorInsertSLC25A46 (SLC25A46 Human)
Tags10xHisExpressionYeastMutationaa 2-83 deletedPromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-Strep-Opa1(MGD) (SB252)
Plasmid#227601PurposeInducible expression of Strep-tagged Opa1(MGD) in Pichia pastorisDepositorInsertOPA1 (OPA1 Human)
TagsTwin-StrepTagExpressionYeastMutationcontains aa 253-580 (MGD) and aa 938-960PromoterAOX1Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-GAL4-PARP1-CAT-L713F
Plasmid#175949PurposeBacterial expression of a fusion of yeast GAL4 DNA binding domain and human PARP1 CAT domain containing L713F gain-of-function mutationDepositorInsertGAL4 DNA binding domain (GAL4 Budding Yeast)
Tags6xHis tagExpressionBacterialMutationL713F, V762A for the 'PARP1-CAT-L713F' …PromoterT7Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxAmp21R
Plasmid#218287PurposeA complete plasmid for ToxAmp (Toxin-antitoxin-driven gene amplification) for the expression of AeBlueDepositorInsertHO(-955, -789)-LoxP>pKlLEU2>KlLEU2>PCRT1>RelB>tPDC1-pTDH3>AeBlue>tSYNth7-ARS712-HO(-731, -264)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxAmp12
Plasmid#218286PurposeMulti-copy integration of heterologous genes (AeBlue and RelB) through co-transformation with ToxAmp (toxin-antitoxin-driven gene amplification) modulesDepositorInsertHO(-253, -1)-pCRT1>RelB>tPDC1-pTDH3>AeBlue>tsynth7-ARS712-HO(-731, -264)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxAmp1
Plasmid#218285PurposeAmplifying the gene copy number of heterologous genes (yEGFP and RelB) through ToxAmp (toxin-antitoxin-driven gene amplification) mechanismDepositorInsertHO(-253, -1)-pRPL8B>RelB>tPDC1-pTEF1>yEGFP>tURA3-ARS712-HO(-731, -264)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxamEXP4CUP1
Plasmid#218284PurposeUse together with pJE13HD7 and pJE13HD7 derivatives to integrate RelE expression cassette under the control of the CUP1 promoter at ho locusDepositorInsertHph>tAgTEF1-ISceI-Repeat2-pCUP1>RelE(1-125)>RPL28intron>RelE(126, 289)>tTPI1-HO(1828, 1979)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4QE2Crimson
Plasmid#218280PurposeIntroduction of a bicistronic expression cassette of yEGFP and E2Crimson under the control of the SkGAL2 promoterDepositorInsertpURA3>KlURA3>tKlURA3-pSkGAL2>yEGFP>ERBV1.2A>E2Crimson>tURA3
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only