We narrowed to 13,850 results for: sequence
-
Plasmid#47787PurposeExpresses enzymatically monobiotinylated full-length TLP ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised TLP
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1431400-bio
Plasmid#47791PurposeExpresses enzymatically monobiotinylated full-length PF3D7_1431400 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised PF3D7_1431400
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-SNCAe3-WT
Plasmid#85847PurposeDonor plasmid for SNCA exon3 wild type sequence. lso contains TagBFP and dTomatoDepositorInsertSNCA exon 3 homology arms (SNCA Human)
ExpressionBacterial and MammalianAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE3-2X
Plasmid#110835PurposeCMV expression vector for BE3-2X construct (not codon optimized)DepositorInsertBE3-2X
ExpressionMammalianMutation2 tandem NLS sequences in the XTEN linkerPromoterCMVAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE3-FNLS
Plasmid#110836PurposeCMV expression vector for BE3-FNLS construct (not codon optimized)DepositorInsertBE3-FNLS
Tags3X FLAGExpressionMammalianMutationNLS sequence at the N-terminusPromoterCMVAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ntng2.a-AP-His
Plasmid#71994PurposeExpresses the extracellular region of the Netrin G2, isoform a protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3XFLAG-MKK7-EE-NLS hygro
Plasmid#87780PurposeInducible expression of constitutively active mutant MKK7 with a C-terminal NLS sequenceDepositorAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
RGS-6xHis-BLMP-1-pcDNA3.1-
Plasmid#52514Purposeexpresses C. elegans BLMP-1 in mammalian cells with RGS-6xHis tag at N-terminusDepositorInsertblmp-1 (blmp-1 Nematode)
Tags6xHisExpressionMammalianMutationN75S mutation compared GenBank reference sequence…PromoterCMVAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.d-AP-His
Plasmid#71987PurposeExpresses the extracellular region of the Netrin G1, isoform d protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.3-Fc-His
Plasmid#72100PurposeExpresses the extracellular region of the Neuropilin 2, isoform 3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.4-Fc-His
Plasmid#72101PurposeExpresses the extracellular region of the Neuropilin 2, isoform 4 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Neo1.c-AP-His
Plasmid#71965PurposeExpresses the extracellular region of the Neogenin 1, isoform c protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Plxnb2(L)-AP-His
Plasmid#72002PurposeExpresses the extracellular region of the PlexinB2 protein (ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.c-Fc-His
Plasmid#72112PurposeExpresses the extracellular region of the Netrin G1, isoform c protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
SIN-cPPT-G1B3-Gateway-WPRE-miR124T
Plasmid#245070PurposeGateway cloning with miRNA-124 target sequence to repress transgene expression in neuronsDepositorInsertGateway
UseLentiviralExpressionMammalianPromoterhuman GFAP fragmentsAvailable SinceMarch 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-HA_WT POLH_deltaGG NEDD8
Plasmid#246412PurposeExpresses HA-tagged WT POLH fused to ΔGG NEDD8 in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsHA and ΔGG NEDD8ExpressionMammalianMutationCoding sequence has been optimised for expression…Available SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_L704A_F707A_F708A (PIP2*) POLH
Plasmid#246283PurposeExpresses L704A_F707A_F708A POLH with a FLAG tag in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAGExpressionMammalianMutationPOLH L704A_F707A_F708A. Coding sequence has been …Available SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT POLH
Plasmid#221897PurposeExpresses WT POLH with a FLAG tag in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAGExpressionMammalianMutationCoding sequence has been optimised for expression…PromoterCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_D652A POLH
Plasmid#222006PurposeExpresses D652A POLH with a FLAG tag in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAGExpressionMammalianMutationPOLH D652A. Coding sequence has been optimised fo…PromoterCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only