We narrowed to 14,331 results for: cas9 genes
-
Plasmid#177347PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterCMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97308PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb MMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97311PurposeMMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb MMEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-AlbEx14-mNG
Plasmid#201780Purposeknocks in mNeonGreen into exon 14 of Alb to produce Alb-mNeonGreen fusion protein in miceDepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97312PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. Lenti backbone.DepositorInsertActb HMEJ donor
UseLentiviral and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pORANGE CACNG2-GFP KI
Plasmid#131504PurposeEndogenous tagging of Tarpγ2/Stargazin: Intramolecular (amino acid position: S265)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97309PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HR donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb NHEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97310PurposeNHEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb NHEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
MKC89_CCR5(UbC-tEPOR-2A-YFP)
Plasmid#232404PurposeAAV production plasmid for UbC-tEPOR-2A-YFP vector from Fig. 2 that mediates HDR at CCR5 locus using CCR5-sg3 gRNA. YFP is followed by a BGH polyA. AAV genome is flanked by AAV2 ITRs.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC91_tEPOR(UbC-GFP-BGH)
Plasmid#232406PurposeAAV production plasmid for tEPOR-UbC-GFP-BGH vector from Fig. 1 that mediates HDR at EPOR locus using EPOR-sg1 gRNA. Repair vector introduces premature stop codon into EPOR locus.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-scFVDnmt3AL_bGHpA
Plasmid#177348PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from Synapisin promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterhuman SynapsineAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-scFVDnmt3AL_bGHpA
Plasmid#177354PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from doxycycine-inducible promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterTetracycline-dependent promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHIV(T9)-DERA-sgresis
Plasmid#222622PurposeLentiviral vector that expresses sgRNA resistant DERA in mammalian cellsDepositorAvailable SinceAug. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5-FRT/T0-EGFP-GNB1L
Plasmid#222621PurposeMammalian expression vector of flag-tagged GNB1LDepositorAvailable SinceAug. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCG-ACTB-C4
Plasmid#229846PurposeExpresses wild-type Cas9 and gRNA for ACTB gene.DepositorInsertguide RNA for ACTB gene
UseCRISPRExpressionMammalianAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX335 Mouse 5' Srcap gRNA B
Plasmid#127905PurposeCas9 D10A Nickase Vector targeting the 5' end of the mouse Srcap geneDepositorInsertSrcap gRNA
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only