We narrowed to 14,368 results for: cas9
-
Plasmid#76124Purpose3rd generation lentiviral gRNA plasmid targeting human MAST1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
FGFR1 gRNA (BRDN0001146877)
Plasmid#76068Purpose3rd generation lentiviral gRNA plasmid targeting human FGFR1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUCY2D gRNA (BRDN0001146790)
Plasmid#76031Purpose3rd generation lentiviral gRNA plasmid targeting human GUCY2DDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUCY2D gRNA (BRDN0001146190)
Plasmid#76032Purpose3rd generation lentiviral gRNA plasmid targeting human GUCY2DDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUCY2D gRNA (BRDN0001147902)
Plasmid#76033Purpose3rd generation lentiviral gRNA plasmid targeting human GUCY2DDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUCY2D gRNA (BRDN0001145533)
Plasmid#76034Purpose3rd generation lentiviral gRNA plasmid targeting human GUCY2DDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
HK3 gRNA (BRDN0001146645)
Plasmid#75779Purpose3rd generation lentiviral gRNA plasmid targeting human HK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
HK3 gRNA (BRDN0001148398)
Plasmid#75780Purpose3rd generation lentiviral gRNA plasmid targeting human HK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
HK3 gRNA (BRDN0001149028)
Plasmid#75781Purpose3rd generation lentiviral gRNA plasmid targeting human HK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
HK3 gRNA (BRDN0001149156)
Plasmid#75782Purpose3rd generation lentiviral gRNA plasmid targeting human HK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-SAGFP
Plasmid#127100PurposeSA-GFP substrate (Addgene #41594) flanked by human AAVS1 homology arms. Endogenous AAVS1 promoter drives T2A-hygromycin expression after integration. SA-GFP cassette contains PGK-puromycin.DepositorInsertSA-GFP reporter
ExpressionMammalianAvailable SinceJune 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE-P48R
Plasmid#161816PurposeExpresses ABE-P48R in mammalian cellsDepositorInsertbpNLS-TadA7.10(P48R)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
UseCRISPRExpressionMammalianMutationD10A in S. pyogenes Cas9, TadA mutations describe…Available SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-MAFA-PQR-NLS-tdTomato-P2A-puro-PGK-puro
Plasmid#121174PurposeDonor template for CRISPR-Cas9 mediated generation of MAFA-NLS-tdTomato reporter cell linesDepositorInsertMAFA-PQR-NLS-tdTomato-P2A-Puro-PGK-Puro
UseCRISPRExpressionMammalianAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-GCG-T2A-NLS-EmGFP-P2A-puro-PGK-puro
Plasmid#121175PurposeDonor template for CRISPR-Cas9 mediated generation of GCG-NLS-EmGFP reporter cell linesDepositorInsertGCG-T2A-NLS-EmGFP-P2A-Puro-PGK-Puro
UseCRISPRExpressionMammalianAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJW1328
Plasmid#69488PurposesgRNA(F+E) targeting pha-1 (no Cas9); for co-conversion in C. elegansDepositorInsertsgRNA(F+E) targeting pha-1
ExpressionWormPromoterR07E5.16 U6 promoterAvailable SinceSept. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA104
Plasmid#245326PurposeCas9 CRISPRa positive control guide; targets CD4DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSG1016-2xBsaI-SaKKH_P2A_EGFP
Plasmid#239461PurposeCodon-optimized S. aureus KKH Cas9. 2x BsaI sites for easy cloning of varying deaminases. EGFP can serve as a transfection marker.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianPromoterCMVAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only