We narrowed to 1,648 results for: CAG promoter
-
Plasmid#62685PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInserttdTomato/amiR-eGFP419/amiR-eGFP123
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pATK (pKD-G9)
Plasmid#62688PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInserttdTomato/amiR-eGFP123/amiR-eGFP419
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO
Plasmid#68357PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and 8, and SMAD4 ex2 and ex 9 are expressed by the U6 promoter.DepositorInserts5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterU6 and synthetic Probasin ARRx2Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Exon-53_Dual_sgRNA
Plasmid#173211PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick exon-53 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 sgRNA + MTOR Nick exon-53 sgRNA
UseCRISPR; Prime editing (pe3)ExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_RUNX1_+4_T_to_G_Dual_pegRNA
Plasmid#173212PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and RUNX1 +4 T to G pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + RUNX1 +4 T to G pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSC51
Plasmid#104825PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.12g075700, Glyma.11g145900 (Drb2ab). Also expresses Cas9 from rolD promoter from Gmubi promoterDepositorInsertGlyma.12g075700, Glyma.11g145900
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
psiCheck2-SV40p-5'UTR-mtIF3(SR)-3xFLAG-3'UTR-CMVp-mito-mTFP1
Plasmid#182378PurposeDual expression construct encoding shRNA-resistant mtIF3 and mito-mTFP1 from separate promotersDepositorInsertsTags3xFlagExpressionMammalianMutationChanged CDS sequence from 'ccacgttcaagtcacga…PromoterCMV promoter and SV40 promoterAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
psiCheck2-SV40p-5'UTR-mtIF3(SR)-3xFLAG-3'UTR-HSVTKp-mCherry
Plasmid#182379PurposeDual expression construct encoding shRNA-resistant mtIF3 and mCherry from separate promotersDepositorInsertsTags3xFlagExpressionMammalianMutationChanged CDS sequence from 'ccacgttcaagtcacga…PromoterHSV TK promoter and SV40 promoterAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-SA-WTmLdlrEx14-gRNA2-N22-HLP-SACas9-HA-OLLAS-spA
Plasmid#206860PurposeAn AAV plasmid with U6 promoter driving a gRNA against LDLR and liver specific HLP promoter driving SaCas9DepositorInsertmLdlr gRNA (Ldlr Mouse)
UseAAV and CRISPRAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
SBC015869
Plasmid#226281PurposeExpresses MsCAD from trc promoter; expresses BsSfp and SrCAR from a separate trc promoter. Biosynthesis of (hydroxy)cinnamyl alcohols from (hydroxy)cinnamic acids.DepositorInserts4'-phosphopantetheinyl transferase Sfp
Cinnamyl alcohol dehydrogenase
Carboxylic acid reductase
ExpressionBacterialAvailable SinceNov. 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pX330_SAFB2gRNA12
Plasmid#196106PurposeContains guide RNA to 3' end of mouse SAFB2 gene for safb1/2 dko. Used with Addgene IDs: 196103, 196107, 196108DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_RUNX1_+1_ATGins_Dual_pegRNA
Plasmid#173213PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and RUNX1 +1 ATG insertion pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + RUNX1 +1 ATG insertion pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC-tracrRNA-PMtU6-26
Plasmid#209191PurposeCloning of sgRNAs for expression in plantsDepositorInsertMtU6-26 SnRNA promoter
UseCloning vectorAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-tracrRNA-PMtU6-1
Plasmid#209190PurposeCloning of sgRNAs for expression in plantsDepositorInsertMtU6-1 SnRNA promoter
UseCloning vectorAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(sgCXCR1-2)-PGKpuro2ABFP-W
Plasmid#252916PurposeExpression vector for gRNA with Puro and tagBFP selection markersDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(sgCXCR1-1)-PGKpuro2ABFP-W
Plasmid#252915PurposeExpression vector for gRNA with Puro and tagBFP selection markersDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2-U3
Plasmid#173156PurposeSingle guide RNA cassette under U3 promoterDepositorInsertsgRNA cassette under U3 promoter
ExpressionPlantPromoterpromoter region of the U3C snRNA gene (Marshallsa…Available SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmIL-6 mut C/EBP
Plasmid#61291Purposedrives luciferase from mouse IL-6 promoter with mutant C/EBP (NF-IL-6) siteDepositorInsertIL-6 promoter (Il6 Mouse)
UseLuciferaseExpressionMammalianMutationMutated C/EBP binding site from ACATTGTGCAATCT to…PromoterIL-6 promoter with mutant C/EBP binding siteAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
WPXL SOX10 gRNA
Plasmid#101923PurposeSOX10 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.DepositorInsertSOX10 promoter targeting gRNA
UseLentiviralAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only