We narrowed to 21,566 results for: Cre
-
Plasmid#118162PurposeCRISPRi negative control. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter, and sgRNA1 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
GAMA-bio
Plasmid#47747PurposeExpresses enzymatically monobiotinylated full-length GAMA ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorPublicationInsertCodon-optimised GAMA
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable sinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMCSF-R(mA)-luc
Plasmid#12421DepositorInsertM-CSF receptor promoter fragment (CSF1R Human)
UseLuciferaseMutationC/EBP binding site mutation (created a KpnI site …Available sinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
1647_pGL4.51 TLV41 SSA-Luc cloning vector_Circular
Plasmid#132962PurposeFirefly-luciferase single-strand annealing assay cloning backboneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFirefly Luciferase
UseCRISPR and LuciferaseExpressionMammalianMutationStop sequence between luciferase genePromoterCMVAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCIneoLuc-TEAD4
Plasmid#128335PurposeVector for LUMIER assayDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTEAD4 (TEAD4 Human)
TagsLuciferaseExpressionMammalianPromoterCMVAvailable sinceSept. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
373_MLH1 in pmiRGlo
Plasmid#78133Purposeluciferase reporter for miRNA activityDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMLH1 (MLH1 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutation3'UTR containing miRNA binding sitesPromoterPGKAvailable sinceMay 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR EGFP-guide1
Plasmid#118162PurposeCRISPRi negative control. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter, and sgRNA1 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
GAMA-bio
Plasmid#47747PurposeExpresses enzymatically monobiotinylated full-length GAMA ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorPublicationInsertCodon-optimised GAMA
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable sinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMCSF-R(mA)-luc
Plasmid#12421DepositorInsertM-CSF receptor promoter fragment (CSF1R Human)
UseLuciferaseMutationC/EBP binding site mutation (created a KpnI site …Available sinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLP-FRT-iGluSnFR4f-NGR-WPRE
Plasmid#234454PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-NGR
UseAAV; Flp/frtTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterSynapsinAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
HA-BACE1-mBFP
Plasmid#196697PurposeExpresses Bace1 with an HA tag at N-terminal for single molecule tracking and other measusers in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBeta-secretase 1 (BACE1 Human)
TagsHA and mBFPExpressionMammalianAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRiboI-Sec-APEX2m
Plasmid#176845PurposeExpression of APEX2 in the periplasm from a codon-optimized gene (single-copy integrating plasmid)DepositorInsertpRibo-Sec-APEX2m
ExpressionBacterialPromoterpRibo, theophilline riboswitch inducible hsp60 pr…Available sinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a_nsp12-His6-3xFlag (SARS-CoV-2)
Plasmid#169182PurposeBaculoviral transfer vector to express nsp12-His6-3xFlag (SARS-CoV-2) in insect cellsDepositorInsertnsp12-His6-3xFlag (ORF1ab SARS-CoV-2, Synthetic)
TagsHis6-3xFlagExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCC_06 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-dCas9NG-NLS-VPR-2A-Puro-WPRE
Plasmid#139091PurposeExpresses human codon-optimized inactive SpCas9-NG fused to a transcriptional activator VPR in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertdSpCas9-NG-VPR
UseCRISPR and LentiviralExpressionMammalianMutationD10A, H840A, L1111R, D1135V,G1218R, E1219F, A1322…Available sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
BAP1-wt (siRNA resistant)
Plasmid#108439PurposeStable expression of BAP1-wt in mammalian cells, gene has an introduced siRNA-resistance against siBAP1.DepositorInsertBAP1 (BAP1 Human)
ExpressionMammalianMutationc.1641C>T, c.1644T>A, c.1647T>C, c.1650C…PromoterCMVAvailable sinceNov. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-Ataxin3-Strep-HA
Plasmid#113496PurposeExpression of human Ataxin-3 with C-terminal strep-HA tagDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAtaxin-3 (ATXN3 Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable sinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA5FRT/TO-DVC1-Strep-HA
Plasmid#113481PurposeExpression of human DVC1 with C-terminal strep-HA tagDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDVC1 (SPRTN Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable sinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-myc3-Mdm2 D367E
Plasmid#52057Purposeexpression of non-cleavable Mdm2 in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMdm2 D367E (MDM2 Human)
Tagsmyc3ExpressionMammalianMutationD367EPromoterCMVAvailable sinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
nes1852tk/lacZ
Plasmid#47613Purposeused to create transgenic mice expressing LacZ reporter with Nestin enhancerDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertnestin 2nd intron (NES Human)
UseEnhancer reporterTagsHSV tk promoter and lacZMutation2nd intron onlyPromoterHSV tk promoterAvailable sinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only