We narrowed to 19,308 results for: cat
-
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pHDR2_DAZL-T2A-mGreenLantern-PuroTK
Plasmid#222917PurposeHomology directed repair template for knocking in mGreenLantern reporter to DAZL.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-FIGLA
Plasmid#222929PurposePiggyBac transposon plasmid for doxycycline inducible expression of FIGLADepositorInsertFIGLA (FIGLA Human)
ExpressionMammalianAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX-UBC_NKX2-1
Plasmid#221495PurposeNKX2-1 short isoform lentiviral overexpression using UBC promoterDepositorAvailable SinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX-hPGK_NKX2-1
Plasmid#221494PurposeNKX2-1 short isoform lentiviral overexpression using hPGK promoterDepositorAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC1-lifeact-oROS-HT
Plasmid#216420PurposeTargeting of the chemigenetic, fluorescent peroxide sensor oROS-HT to actin filaments.DepositorInsertlifeact-oROS-HT
ExpressionMammalianPromoterCMVAvailable SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-N1303K-ngRNA+14_EF1a-puroR
Plasmid#207359PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of N1303K-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertN1303K-CFTR +14 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
12URA-B-ScTop2∆CTD
Plasmid#214924PurposeYeast expression vector 6xHisTag-TEV at N terminus to express S cerevisiae topoisomerase II (1–1177)DepositorInserttopoisomerase II
Tags6x His-TEVExpressionYeastMutationDeleted amino acids 1178-1428PromoterGal 1/10Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(GATA3(13))-PGKpuro2ABFP-W
Plasmid#208548PurposeLentiviral vector expressing gRNA targeting human GATA3DepositorInsertGATA3(13) (GATA3 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAf-CRISPR-phoA
Plasmid#207991PurposeCRISPR vector used with pAf-CRISPR-ctfR1 (#207992) to delete both aflatoxin and cyclopiazonic acid gene clusters of Aspergillus flavusDepositorInsertphoA
UseCRISPRPromoterAspergillus flavus U6Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKT-CNP-inact
Plasmid#211804PurposeExpresses inactive 2',3'-cyclic nucleotide phosphodiesterase catalytic domain (catalytic residues mutated)DepositorInsert2',3'-cyclic nucleotide phosphodiesterase catalytic domain (Cnp Rat)
ExpressionBacterialMutationH73L H153LPromotertetAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
STIM1-2Strep
Plasmid#210361PurposeExpresses STIM1 fused with 2Strep in mammalian cellsDepositorAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+pPGI+NAT+tNOS+ku70 insD (SBE217)
Plasmid#195049Purposeintegration cassette for ku70 deletion and expression of NAT gene under pPGI for characterizationDepositorInsertNAT
ExpressionBacterialPromoterpPGIAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-MYO10ΔF3
Plasmid#194857PurposeExpress EGFP-MYO10 with the F3 FERM domain lobes deleted (1-1951) in mammalian cells.DepositorInsertMYO10 ΔF3 (MYO10 Human)
TagsEGFPExpressionMammalianMutationTruncated MYO10 construct. MYO10 amino acids 1-1…PromoterCMVAvailable SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_zeo
Plasmid#184913PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_zeo recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-ECT2_sgRNA
Plasmid#183873PurposepX459V2.0-HypaCas9 plasmid with ECT2 sgRNA for N-terminal tagging of Ect2 in human cells.DepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_hph
Plasmid#184915PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_hph recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_zeo
Plasmid#184917PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_zeo recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dCTNNA1
Plasmid#176032PurposeA knock-out vector for dog CTNNA1 (alpha-1-catenin)DepositorInsertA gRNA targeting the dog CTNNA1 (alpha-1-catenin) gene and the cDNA of Cas9 (CTNNA1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pINER4R
Plasmid#185884PurposeIn vivo gene amplification (HapAmp) of nerolidol synthetic module locus (25 copy).DepositorInsertPRPL25(Arm1)>Kl.LEU2>TKl.LEU2-PGAL1>ERG20>TRPL3-TRPL25(Arm3)-ARS305-PGAL2>Y.FAST-EVBR1.2A-AcNES1>TRPL41B-PBTS1>RPL25(part;Arm2)
ExpressionYeastMutationNoneAvailable SinceSept. 1, 2022AvailabilityAcademic Institutions and Nonprofits only