We narrowed to 19,412 results for: Tat
-
Plasmid#12058DepositorInsertN4 3'UTR mut (LRRK1 Human)
UseLuciferaseExpressionMammalianMutationMutations in microRNA recognition sites (seed mat…Available SinceJune 2, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAG87 DUXAP6 3'UTR mut
Plasmid#12060DepositorInsertN6 3'UTR mut (DUXAP6 Human)
UseLuciferaseExpressionMammalianMutationMutations in microRNA recognition sites (seed mat…Available SinceJune 2, 2006AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-FLAG-HA-CAD_WT-HA-Hygro
Plasmid#253792PurposepLenti lentiviral expression vector encoding FLAG- and HA-tagged human wild-type CAD under a human PGK promoter.DepositorAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEF1-PA-GFP-H4-FRT
Plasmid#247333PurposeExpresses histone H4 fused with photoactivatable-GFPDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-DIO-SEP-GluA2Q
Plasmid#227234PurposeLarge cargo capacity AAV that expresses SEP tagged AMPA receptor subunit GluA2 R607Q mutant in neurons expressing Cre recombinaseDepositorInsertSEP-GluA2 (Gria2 )
UseAAVTagssuperecliptic pHluorinExpressionMammalianMutationQ607RPromoterhSyn1Available SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-DIO-AppNL-G-F-P2A-EGFP
Plasmid#242648PurposeFloxed (DIO) AAV transgene designed to be packaged in AAV and to express the amyloid precursor protein (App) with familial mutations AppNL-G-F in a Cre-recombinase dependent manner.DepositorInsertFloxed (DOI) AAV transgene with human synapsin promoter driving amyloid precursor protein with familial mutations and EGFP tag
UseAAV, Cre/Lox, and Mouse TargetingTagsEGFPExpressionMammalianPromoterhuman synapsinAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLex307-UCOE-SFFV-puroR-MCP-MLLx3-HSF1
Plasmid#218558PurposeEncodes SFFV promoter-driven MCP-MLLx3-HSF1 with an N-terminal bipartite SV40 NLS, along with puromycin resistanceDepositorInsertMCP-MLLx3-HSF1
UseLentiviralTagsSV40NLSExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…Available SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLex307-UCOE-SFFV-puroR-MCP-P65-HSF1
Plasmid#218559PurposeEncodes SFFV promoter-driven MCP-P65-HSF1 with an N-terminal bipartite SV40 NLS, along with puromycin resistanceDepositorInsertMCP-P65-HSF1
UseLentiviralTagsSV40NLSExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…Available SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Kan-ADE2
Plasmid#232105PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pScalps-Puro-FLAG_HA-Regnase-1 D141N
Plasmid#222663PurposeLentiviral vector to express mouse Regnase-1 D141N mutant tagged with FLAG-HA at N-termDepositorInsertZc3h12a (Zc3h12a Mouse)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationmutated aspartic acid 141 to asparagine to abroga…PromoterSFFVAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-FLAG-hM4D(Gi)-P2A-ArgiNLS-AausFP1
Plasmid#220613PurposeCre-dependent co-expression of FLAG-tagged inhibitory hM4D(Gi) DREADD receptor, and a single-cell discriminating version of AausFP1 as a reporter.DepositorInsertFLAG-hM4D(Gi)-P2A-ArgiNLS-AausFP1
UseAAV and Cre/LoxTagsFLAG; ArgiNLSExpressionMammalianPromoterEF1aAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRoC30_Th3.14
Plasmid#188068PurposeFuncLib-designed high-redox potential laccase from Trametes hirsuta (Th3.14)DepositorInsertFuncLib-designed high-redox potential laccase from Trametes hirsuta
TagsS. cerevisiae evolved α-factor prepro-leader sign…ExpressionYeastMutation20 PROSS + 4 FuncLib mutations, described in publ…Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Sec22b-shR
Plasmid#208358PurposeMammalian expression of fluorescent N-terminally tagged shRNA resistant Sec22bDepositorInsertSec22b (Sec22b Rat)
TagsEGFPExpressionMammalianMutationfour silent mutations introduced to render shRNA …PromoterCMVAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Flag-FBW7K404R
Plasmid#200717PurposeThe plasmid expresses Flag-tagged FBW7 human isoform 1 with Lys404 to Arg mutation. Used for mammalian overexpression and detection by western blotting.DepositorInsertFBW7 (FBXW7 Human)
TagsFlagExpressionMammalianMutationFBW7 K404 is mutated to Alanine.PromoterCMVAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
5K-tails-->R GLUT1-GFP
Plasmid#200099Purposehuman GLUT1 with K-->R mutation of 5 lysines on the N- and C-terminal tails with a C-terminal tag in pQCXIP vectorDepositorInsertGLUT1 (SLC2A1 Human)
UseRetroviralTagsGFPExpressionMammalianMutationK-->R mutations of amino acids 6, 7, 451, 456,…PromoterCMVAvailable SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1-P1257Y_R
Plasmid#147375PurposeMammalian Expression of HsNot1iso1-P1257YDepositorInsertHsNot1iso1-P1257Y (CNOT1 Human)
ExpressionMammalianMutationA deletion of 5 AA 822-827 SKMKPS-> T and one …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1-V1251R_R
Plasmid#147376PurposeMammalian Expression of HsNot1iso1-V1251RDepositorInsertHsNot1iso1-V1251R (CNOT1 Human)
ExpressionMammalianMutationA deletion of 5 AA 822-827 SKMKPS-> T and one …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-NPHS1-Fc(DAPA)-AviTag-6xHis
Plasmid#157023PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertNPHS1 (NPHS1 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-IGDCC4-Fc(DAPA)-AviTag-6xHis
Plasmid#157005PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertIGDCC4 (IGDCC4 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only