We narrowed to 14,266 results for: crispr grnas
-
Plasmid#230947PurposeaTc inducible knockdown of FliZDepositorInsertdCas9
UseCRISPRMutationadditional tetOAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKDcas9 23 cerulean
Plasmid#230949PurposeaTc inducible knockdown of Fis and HNSDepositorInsertdCas9
UseCRISPRMutationadditional tetOAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKDcas9 45 cerulean
Plasmid#230951PurposeaTc inducible knockdown of mcaS and CsgDDepositorInsertdCas9
UseCRISPRMutationadditional tetOAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKDcas9 56 cerulean
Plasmid#230952PurposeaTc inducible knockdown of CsgD and FlhDCDepositorInsertdCas9
UseCRISPRMutationadditional tetOAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKDcas9 67 cerulean
Plasmid#230953PurposeaTc inducible knockdown of FlhDC and FliZDepositorInsertdCas9
UseCRISPRMutationadditional tetOAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-sgCTG-SlugD10A-3XFLAG-SV40 NLS-ITR2
Plasmid#222857PurposeThis plasmid codes for the Slug-KH nickase with a sg(CTG)6DepositorInsertSlug-KHD10A+sgCTG
UseCRISPRTags3X FLAG, SV40 NLS, ITR2 and ITR2ExpressionMammalianMutationKH variant and D10A mutationPromoterH1 and eCMVAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-sgAGC-SlugD10A-3XFLAG-SV40 NLS-ITR2
Plasmid#222859PurposeThis plasmid codes for the Slug-KH nickase with a sg(AGC)6DepositorInsertSlug-KHD10A+sgAGC
UseCRISPRTags3X FLAG, SV40 NLS, ITR2 and ITR2ExpressionMammalianMutationKH variant and D10A mutationPromoterH1 and eCMVAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-sgCAG-SlugD10A-3XFLAG-SV40 NLS-ITR2
Plasmid#222858PurposeThis plasmid codes for the Slug-KH nickase with a sg(CAG)6DepositorInsertSlug-KHD10A+sgCAG
UseCRISPRTags3X FLAG, SV40 NLS, ITR2 and ITR2ExpressionMammalianMutationKH variant and D10A mutationPromoterH1 and eCMVAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-sgGCA-SlugD10A-3XFLAG-SV40 NLS-ITR2
Plasmid#222860PurposeThis plasmid codes for the Slug-KH nickase with a sg(GCA)6DepositorInsertSlug-KHD10A+sgGCA
UseCRISPRTags3X FLAG, SV40 NLS, ITR2 and ITR2ExpressionMammalianMutationKH variant and D10A mutationPromoterH1 and eCMVAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-Vamp2-GeneTRAP
Plasmid#218187PurposeTo KO and genetrap mouse Vamp2 simultaneouslyDepositorInsertsgRNA (Vamp2 Mouse)
UseAAV and CRISPRAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEARBOCS-v0- Gfap-TagIN-mCherry
Plasmid#196490PurposeTo tag endogenous mouse GFAP with mCherryDepositorInsertsmCherry
gRNA
UseAAV and CRISPRExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEARBOCS-v0-Vamp2-TagIN-HA
Plasmid#196494PurposeTo tag endogenous mouse VAMP2 with HADepositorInsertsHA
gRNA
UseAAV and CRISPRExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS160
Plasmid#215682PurposeGuide only plasmid targeting chrI split hygromycinR landing padDepositorInsertU6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-gR082
Plasmid#188551PurposeGateway entry vector for sgRNA targeted to MpIGPD.Transient expression of sgRNA targeted to MpIGPD in Marchantia polymorpha.DepositorInsertgR082
UseCRISPR; Entry vectorAvailable SinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-gR085
Plasmid#188552PurposeGateway entry vector for sgRNA targeted to MpIGPD.Transient expression of sgRNA targeted to MpIGPD in Marchantia polymorpha.DepositorInsertgR085
UseCRISPR; Entry vectorAvailable SinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSUI-SynP-CAS1sg
Plasmid#154341PurposeExpression of the sgRNA targeting to the E. coli can geneDepositorInsertCAS1 sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUI-SynP-CAS2sg
Plasmid#154342PurposeExpression of the sgRNA targeting to the E. coli can geneDepositorInsertCAS2 sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUI-SynP-CANTsg
Plasmid#154343PurposeExpression of the sgRNA targeting to the E. coli can geneDepositorInsertCANT sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUI-SynP-CAPsg
Plasmid#154344PurposeExpression of the sgRNA targeting to the E. coli can geneDepositorInsertCAP sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051-sgCh2-2
Plasmid#125775Purposeconstitutive expression of a guide RNA targeting an intergenic region of human chromosome 2 (CRISPR cutting control) and S. pyogenes Cas9DepositorInsertsgCh2-2
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only