We narrowed to 17,560 results for: POR
-
Plasmid#27204DepositorInsertZinc finger array targeting mdka (mdka Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
RON2-COMP-blac-flag-his
Plasmid#110962PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertrhoptry neck protein 2 (RON2) (PF3D7_1452000 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_0620000-COMP-blac-flag-his
Plasmid#110993PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertsecreted ookinete protein 25, putative (PF3D7_0620000 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
CACNA1D (2of2) or cav1.3b_L (OZ547)
Plasmid#28072DepositorInsertZinc finger array targeting CACNA1D (2of2) or cav1.3b (cacna1db Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
CACNA1D (2of2) or cav1.3b_R (OZ548)
Plasmid#28073DepositorInsertZinc finger array targeting CACNA1D (2of2) or cav1.3b (cacna1db Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON HaloTag-STIM2 WPRE
Plasmid#236235PurposeAAV expression of human STIM2 internally tagged with HaloTagDepositorInsertHaloTag-STIM2 (STIM2 Human)
UseAAVTagsHaloTag in position 29MutationSignal peptide from STIM1 and residues 15-746 of …Promoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc msfGFPΔC10-Utr28-222
Plasmid#231558PurposeExpresses N- and C-terminally truncated Utrophin calponin homology domain fused to C-terminally truncated msfGFP for actin filament organization measurements using fluorescence polarization microscopyDepositorInsertUtrophin calponin homology domain (UTRN Human)
TagsmsfGFPExpressionMammalianPromoterCMVtruncAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BRAF-REG-T241P-Halo
Plasmid#202549PurposeMammalian expression construct encoding the BRAF regulatory (REG) domain (AA 1-435) with a C-terminal HaloTag. The REG domain contains the RASopathy mutation, T241P, within its cysteine-rich domain.DepositorInsertBRAF regulatory (REG) domain (AA 1-435) (BRAF Human)
TagsHaloTagExpressionMammalianMutationThreonine 241 mutated to prolinePromoterCMVAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform2_untagged-Puro
Plasmid#192002PurposeLentiviral vector to generate LYSET(TMEM251)-isoform2 stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform1_I142V-Puro
Plasmid#192004PurposeLentiviral vector to generate LYSET(TMEM251)-isoform1 I142V mutant stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform1_R45W-Puro
Plasmid#192003PurposeLentiviral vector to generate LYSET(TMEM251)-isoform1 R45W mutant stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform2-I142V-Flag
Plasmid#192006PurposeLentiviral vector to generate flag-tagged LYSET(TMEM251)-isoform2 I142V mutant stable expressing cell line under CMVTRE3G promoterDepositorInsertLYSET-Isoform2-I142V-Flag (LYSET Human)
UseLentiviralTagsFlagExpressionMammalianPromoterCMVTRE3GAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform2-R45W-Flag
Plasmid#192005PurposeLentiviral vector to generate flag-tagged LYSET(TMEM251)-isoform2 R45W mutant stable expressing cell line under CMVTRE3G promoterDepositorInsertLYSET-Isoform2-R45W (LYSET Human)
UseLentiviralTagsFlagExpressionMammalianPromoterCMVTRE3GAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1a-EGFP-PolB-T2A-Myc-SIRT6(PAMmut-G60A)
Plasmid#176144PurposeEGFP fused to the N-terminus of POLB, linked by T2A to N-terminus Myc-tagged SIRT6 with the mutation Gly60Ala, a mutation in the PAM site used by SIRT6-KO gRNA1 & a hygromycin resistance cassetteDepositorInsertPolB-T2A-SIRT6 (POLB Human)
UseLentiviralTagsEGFPExpressionMammalianMutationMutation in Gly60 to Ala, and a mutation in the P…PromoterEF1AAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1a-EGFP-PolB-T2A-Myc-SIRT6(PAMmut-R65A)
Plasmid#176143PurposeEGFP fused the N-terminus of POLB, linked by T2A to N-terminus Myc-tagged SIRT6 with the mutation Arg65Ala, a mutation in the PAM site used by SIRT6-KO gRNA1 & a hygromycin resistance cassetteDepositorInsertPolB-T2A-SIRT6 (POLB Human)
UseLentiviralTagsEGFPExpressionMammalianMutationMutation in Arg65 to Ala, and a mutation in the P…PromoterEF1AAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-EGFP-PolB-(K35A/K68A/K72A)-PAMmut-Hygro
Plasmid#176089PurposeEGFP fused the N-terminus of POLB containing the mutations Lys35Ala, Lys68Ala, and Lys72Ala, a mutation in the PAM site used by POLB gRNA1 & a hygromycin resistance cassetteDepositorInsertPolB (POLB Human)
UseLentiviralTagsEGFPExpressionMammalianMutationMutations in Lys35 to Ala, Lys68 to Ala, and Lys7…PromoterCMVAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-MAGT1_STOP
Plasmid#161468PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertMAGT1 (MAGT1 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
GFP-Cstem(7A)-Tac(5A)
Plasmid#162499PurposeExpresses GFP tagged Tac mutant in mammalian cells. The five O-glycosylation sites in the stem region are mutated, and the stem region of CD8a with mutations is inserted between GFP and Tac(5A).DepositorInsertTagsGFPExpressionMammalianMutationThe five theronine and two serine residues are mu…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only