We narrowed to 9,093 results for: sgRNA
-
Plasmid#46917PurposeHuman pSico-based U6 vector containing murine U6 promoter and sgRNA targeting endogenous CXCR4 geneDepositorInsertsUseCRISPR and LentiviralExpressionMammalianPromoterCMV and U6Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only
-
pLKO.1-puro U6 N. meningitidis sgRNA BfuAI large stuffer
Plasmid#86195PurposeU6 based expression of N meningitidis sgRNADepositorInsertnmCas9 sgRNA cloning cassete
UseLentiviralPromoterU6Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTK73.ChrV_oxTi365.gRNA
Plasmid#194052PurposesgRNA targeting ChrV_oxTi365 locus of the C. elegans genomeDepositorInsertChrV_oxTi365 sgRNA
ExpressionWormPromoterU6Available SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCF820-sgCIDE-1_U6-sgRNA-EF1a-mCherry2
Plasmid#211649PurposeU6-sgRNA-EF1a-mCherry2DepositorInsertsgCIDE-1 sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF820-sgCIDE-2_U6-sgRNA-EF1a-mCherry2
Plasmid#211650PurposeU6-sgRNA-EF1a-mCherry2DepositorInsertsgCIDE-2 sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLY171
Plasmid#184145PurposesgRNA with 3 RNA aptemers BoxB at the 3'-end for CRISPRaDepositorInsertsgRNA-LEA2-ex3
UseSynthetic BiologyPromoterPlux2Available SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVC-Ds-DrU6a:scrambled1-sgRNA-Ds
Plasmid#119070PurposeConstruct with scrambled-1 sgRNA sequence for microinjections in zebrafishDepositorInsertU6a:scrambled1-sgRNA
ExpressionBacterialPromoterZebrafish U6a promoterAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVC-Ds-DrU6a:scrambled2-sgRNA-Ds
Plasmid#119071PurposeConstruct with scrambled-2 sgRNA sequence for microinjections in zebrafishDepositorInsertU6a:scrambled2-sgRNA
ExpressionBacterialPromoterZebrafish U6a promoterAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVC-Ds-DrU6a:scrambled3-sgRNA-Ds
Plasmid#119072PurposeConstruct with scrambled-3 sgRNA sequence for microinjections in zebrafishDepositorInsertU6a:scrambled3-sgRNA
ExpressionBacterialPromoterZebrafish U6a promoterAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVC-Ds-DrU6a:scrambled4-sgRNA-Ds
Plasmid#119073PurposeConstruct with scrambled-4 sgRNA sequence for microinjections in zebrafishDepositorInsertU6a:scrambled4-sgRNA
ExpressionBacterialPromoterZebrafish U6a promoterAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C16orf80 sgRNA 1
Plasmid#70651PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C16orf80 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C16orf80
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C16orf80 sgRNA 2
Plasmid#70650PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C16orf80 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C16orf80
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C3orf17 sgRNA 2
Plasmid#70653PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C3orf17 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C3orf17
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
Human CRISPR lncRNA activation library (SAM) in lenti sgRNA(MS2)_zeo backbone
Pooled Library#1000000106PurposeHuman CRISPR Synergistic Activation Mediator (SAM) pooled library for the transcriptional activation of lncRNAsDepositorAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AC EJ7-GFP
Plasmid#113617PurposeReporter for canonical-NHEJ. Reporter for end joining between two double-strand breaks, induced with the 7a and 7b sgRNAs with CAS9. EJ between the distal ends w/o indel mutations restores GFPDepositorInsertEJ7-GFP variant of EGFP
ExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNC-Y
Plasmid#238998PurposeNode C carrying sgRNA-1 that can be used for the assembly of pEND-11Y or pEND-ZYDepositorInsertsgRNA-1 downstream of a weak constitutive promoter and a binding site for sgRNA-2
UseSynthetic BiologyExpressionBacterialMutationWTAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSET-dCas9-actII-4-NT-S1
Plasmid#110185PurposeRepression of gene expression in Streptomyces by CRISPRiDepositorInsertsdCas9
sgRNA
UseCRISPR; IExpressionBacterialMutationD10A, H840APromoterJ23119 and ermE*pAvailable SinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
gRNA-HEK3-Puro
Plasmid#136282PurposeExpresses a guide RNA targeting HEK3 siteDepositorInsertsgRNA-HEK3
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 C64Y
Plasmid#139326PurposePlasmid expressing a sgRNA to introduce BRCA1 C64Y using base editingDepositorInsertsgRNA to insert BRCA1 C64Y using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only