We narrowed to 23,671 results for: CRISPR
-
Plasmid#117919PurposeExpresses 3xFLAG-NLS-SpCas9-NG-NLS in mammalian cells.DepositorInsertSpCas9-NG (L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R)
ExpressionMammalianAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-MMLVgag-D3A-3L-dCas9-ZIM3
Plasmid#240531PurposeExpresses MMLVgag–DNMT3A-3L-dCas9-ZIM3 for producing RENDER-DNMT3A-3L-dCas9-ZIM3DepositorInsertMMLVgag-D3A-3L-dCas9-ZIM3
TagsFLAG, HAExpressionMammalianAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
loxP-G418-LoxP-TurboID-Rab11 HR
Plasmid#230026PurposeHomology repair plasmid for endogenous tagging of Rab11 at the N-terminus with TurboID and a V5 epitope tag. Contains a G418 resistance cassette for selection of edited cellsDepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
U6-5'+3' MS2-CircRNA
Plasmid#213752PurposeFor circular RNA-mediated prime editor using U6-5'+3' MS2-CircRNA in HEK293T cellsDepositorInsert5' ribozyme, 5' ligation sequences, 5' MS2, 3' MS2, 3' ligation sequences, 3' ribozyme
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC13N-dCas9-BFP-KRAB
Plasmid#127968Purposeconstitutive expression of dCas9-BFP-KRAB from the CLYBL locus (Ward lab)DepositorInsertCLYBL-CAG-dCas9-NLS-BFP-KRAB
UseTALENExpressionMammalianPromoterCAGAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1
Plasmid#79873PurposeBacillus subtilis dCas9 expression vector; integrates into lacA/ganADepositorInsertdCas9
UseCRISPRExpressionBacterialMutationD10A, H840APromoterxylAAvailable SinceOct. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
DD-Cas9 with filler sequence and Venus (EDCPV)
Plasmid#90085PurposeThis plasmid contains destabilized Cas9 and has Venus after P2A sequence. This vector also contains filler sequence which required to be remove for cloning of desired sgRNADepositorInsertCas9
UseCRISPR and LentiviralTagsDestabilized Domain and FlagExpressionMammalianPromoterEFSAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJMP2
Plasmid#79874PurposeBacillus subtilis sgRNA expression vector; integrates into amyEDepositorInsertsgRNA RR1
UseCRISPRExpressionBacterialPromotervegAvailable SinceSept. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:dCas9:TV:Tnos (GB2047)
Plasmid#160626PurposeTU for the constitutive expression of dCas9 fused to TV (TALx6 - VP128) activation domainsDepositorInsertP35s-dCas9:TV-Tnos
ExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLSB-NAT
Plasmid#166698PurposeCombined sgRNA/Cas9 pLSB vector with natMX6 (cloNAT) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
ExpressionYeastPromoteradh15 promoter and tRNA promoterAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRG01-U6-DR-crRNA-BsmbI(x2)-6T; EFS-Puro-2A-Fluc-WPRE
Plasmid#123362PurposeLentiviral vector with empty U6 cassette containing LbCpf1 direct repeat and U6 terminator, with constitutive expression of puromycin resistance and Firefly luciferase.DepositorInsertFirefly luciferase
UseCRISPR, Lentiviral, and LuciferaseExpressionMammalianPromoterEFSAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSL1145 (pSPIN, pBBR1 backbone, R*MmeI)
Plasmid#160736PurposeSingle-plasmid V. cholerae CAST, encodes all proteins, crRNA, and donor DNA. Non-targeting crRNA with BsaI sites for spacer cloning. Mini-tn has MmeI site in R end for Tn-seq. pBBR1 backbone.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC78
Plasmid#62339PurposesgRNA + 1x COM with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: CATACTTCTGCCTGCT…PromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMS81(rpl-28p::mKate2::unc-54 3'UTR::LoxP::rps-0p::HYGR∆)
Plasmid#154840PurposeInsertion of rpl-28p::mKate2::unc-54 3'UTR into a split hygromycin landing pad. Can be modified to insert a different gene(s) of interest.DepositorInserthomology arm:rpl-28p::mKate2::unc-54 3'UTR::LoxP::rps-0p::HYGR∆
UseCRISPR and Cre/LoxExpressionWormMutationHYGR∆ encodes aa 1-226Available SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
lenti SYN-FLAG-dCas9-VPR
Plasmid#114196PurposeLentivirus compatible dCas9-VPR construct driven by the human SYN promoterDepositorInsertdCas9-VPR
UseLentiviralTagsFLAGExpressionMammalianPromoterSYNAvailable SinceSept. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
SunTagng22aa
Plasmid#106438PurposeEncodes a SunTag CRISPR cas9 system that does not contain a guide RNA and therefore, does not target the TET1 catalytic domain to any specific region of the genome.DepositorInsertNOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA15.0 Cas9
Plasmid#138944PurposeFungal AMA1 plasmid with sp-Cas9, ribozymes based "plug-and-play" sgRNA transcription unit, Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_Cas9_2xNLS; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-hCas3
Plasmid#134920PurposeComponents for genome editing in mammalian cells with pCAG-All-in-one-hCascade and pBS-U6-crRNA-targeted.DepositorInsertCas3 with bpNLS
ExpressionMammalianPromoterCAGAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLY017SB_pAAV-U6sg(BbsI)-EFS-Thy1.1-P2A-SB100X
Plasmid#192151PurposeT cell CRISPR AAV-SB vectorDepositorTypeEmpty backboneUseAAVExpressionMammalianMutationNAAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only