We narrowed to 12,232 results for: 110
-
Plasmid#248165PurposeExpresses full-length human LGP2 in sf9 insect cellsDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only
-
PLCe EF-C
Plasmid#244968PurposeExpresses N-terminal truncation of phospholipase Ce in mammalian cells (EF hands 1/2- Cterminus)DepositorInsertphospholipase C epsilon (Plce1 Rat)
TagsFLAGExpressionMammalianMutationN-terminal truncation that removes residues 1-103…PromoterCMVAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLCe PH-C
Plasmid#244967PurposeExpresses N-terminal truncation of phospholipase Ce in mammalian cells (PH domain - C-terminus)DepositorInsertphospholipase C epsilon (Plce1 Rat)
TagsFLAGExpressionMammalianMutationN-terminal truncation that removes residues 1-836PromoterCMVAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDonr 201_USP7_AA535-889
Plasmid#240323PurposeEntry vector for Gateway with USP11 (AA535-889)DepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDonr 201_USP7_AA535-776
Plasmid#240322PurposeEntry vector for Gateway with USP10 (AA535-776)DepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDonr 201_USP7
Plasmid#240319PurposeEntry vector for Gateway with USP7DepositorInsertUSP7 (USP7 Human)
ExpressionBacterialAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDonr 201_USP7_AA1-208
Plasmid#240321PurposeEntry vector for Gateway with USP9 (AA1-208)DepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDonr 201_USP7_C223S
Plasmid#240320PurposeEntry vector for Gateway with USP8 (C223A)DepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET24+ CUL5(1-384)
Plasmid#246504PurposeRecombinant protein expression of CUL5(1-384)DepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA1
Plasmid#166889PurposeLentivirus for inducible knockdown of human AHRDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA3
Plasmid#166909PurposeLentivirus for inducible knockdown of human AHRDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZNpF-∆11cag
Plasmid#245370PurposeDual luciferase (nano, firefly) with Zfp423 5' end fused to NanoLuciferaseDepositorInsertZfp423-∆11cag (Zfp423 Mouse)
UseLuciferase and Synthetic BiologyTagsNanoLuciferaseExpressionMammalianMutation11-bp deletion, H96Wfs*4, plus 3 synonymous mutat…PromoterEF1aAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZNpF-∆7cg
Plasmid#245371PurposeDual luciferase (nano, firefly) with Zfp423 5' end fused to NanoLuciferaseDepositorInsertZfp423-∆7cg (Zfp423 Mouse)
UseLuciferase and Synthetic BiologyTagsNanoLuciferaseExpressionMammalianMutation7-bp deletion, H96Vfs*29, plus 2 synonymous mutat…PromoterEF1aAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZNpF-∆48∆11
Plasmid#245369PurposeDual luciferase (nano, firefly) with Zfp423 5' end fused to NanoLuciferaseDepositorInsertZfp423-∆48∆11 (Zfp423 Mouse)
UseLuciferase and Synthetic BiologyTagsNanoLuciferaseExpressionMammalianMutation11-bp deletion, H96Wfs*4, plus synthetic 48-bp up…PromoterEF1aAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSmBit-CHIP-G132N
Plasmid#236065PurposeSmBit-CHIP expression with G132N substitutionDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSmBit-CHIP-K30A
Plasmid#236066PurposeSmBit-CHIP expression with K30A substitutionDepositorAvailable SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only