We narrowed to 16,198 results for: grna
-
Plasmid#246306PurposeEvaluation of a synthetic Pol III promoter based on the MtU6.6 promoter for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertMtU6.6m1 promoter
UseCRISPRExpressionPlantPromoterMtU6.6m1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-29
Plasmid#246312PurposeEvaluation of PtU6.2 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertPtU6.2 promoter
UseCRISPRExpressionPlantPromoterPtU6.2 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA2
Plasmid#166908PurposeLentivirus for inducible knockdown of human AHRDepositorInsertAHR shRNA
UseLentiviralExpressionMammalianAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-tetR
Plasmid#238043PurposeModified ADEPT-pCas9 with sfGFP under TtrB promoter for tetrathionate (TTR) sensing.DepositorInsertsfGFP
UseSynthetic BiologyPromoterttrBAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp1
Plasmid#238034PurposeEncodes sfGFPunder lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-TO-g0 (FLP-IN)
Plasmid#236120PurposePlasmid encoding g0 guide RNA under control of CMV promoter with two TetR binding sites, used to equalize plasmid masses for transfectionDepositorInsertg0
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCambia3301-AtU6-MAR1
Plasmid#210757PurposeMutagenesis of the Arabidopsis MAR1 gene for efficient screening.DepositorInsertAtU6-26 pro::MAR1 sgRNA
UseCRISPRExpressionPlantPromoterAtU6-26Available SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKJ247
Plasmid#228714PurposeMammalian expression of U6 epPsaCas12f RNF2 targeting guideDepositorArticleInsertu6-RNF2 targeting guide
UseCRISPRExpressionMammalianAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-LCAmp-trxB
Plasmid#202465PurposeExpresses a guide RNA to silence trxB after phosphate depletionDepositorInserttrxB guide RNA
ExpressionBacterialPromoterugpBAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgTelo
Plasmid#227392PurposeAdhesion module, guide RNA recognizes telomeresDepositorInsertguide RNA targeting telomeres
UseLentiviralAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpyA-GFP
Plasmid#220189PurposesgRNA expression vector - pEM7 promoter with GFP in sgRNA siteDepositorInsertpEM7 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpEM7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpyD-GFP
Plasmid#220192PurposesgRNA expression vector - pBG28 promoter with GFP in sgRNA siteDepositorInsertpBG28 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpBG28Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (RAB7A-GAC site)
Plasmid#170140PurposeAAV vector carrying a MS2 adRNA targeting the RAB7A transcriptDepositorInsertMS2-RAB7A(GAC)-MS2
UseAAVExpressionMammalianPromoterHuman U6Available SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGK43
Plasmid#222223PurposeEdits NPAS2 Gene.DepositorAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC0.425
Plasmid#203944PurposeUp Flank. Up flanking region of RSF1010-Cas12a vector for introducing gRNA expression cassette and swapping out the AbR.DepositorInsertCas12a UP
UseSynthetic BiologyAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC0.426
Plasmid#203945PurposeDown Flank. Down flanking region of RSF1010-Cas12a vector for introducing gRNA expression cassette and swapping out the AbR.DepositorInsertCas12a DOWN
UseSynthetic BiologyAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKJ221
Plasmid#212319PurposeExpress MmFnuc guide with pureexpressDepositorInsertMercenaria guide
ExpressionBacterialAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-GST-EGFP-GPIDAF
Plasmid#213716PurposeFor lentiviral expression of shRNA under a U6 promoter, accompanied by the expression of the affinity sorting tag GST-EGFP-GPIDAF driven by an hPGK promoter.DepositorInsertEGFP
TagsGSTExpressionMammalianPromoterhPGKAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only