We narrowed to 13,850 results for: sequence
-
Plasmid#72189PurposeExpresses the 10 N-terminal extracellular domains of the Dscam, isoform 7.27.26 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertDscam1_7.27.26
TagsFc-HisExpressionMammalianPromoterCMVAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
Dscam1_7.27.23 EC10-Fc-His
Plasmid#72187PurposeExpresses the 10 N-terminal extracellular domains of the Dscam, isoform 7.27.23 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertDscam1_7.27.23
TagsFc-HisExpressionMammalianPromoterCMVAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
Dscam1_7.27.26 EC10-AP-His
Plasmid#72063PurposeExpresses the 10 N-terminal extracellular domains of the Dscam, isoform 7.27.26 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertDscam1_7.27.26
TagsAP-HisExpressionMammalianPromoterCMVAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
rd
Plasmid#112912PurposeExpress the PEST domain-replaced 48 kDa form of human dematin with a cleavable N-terminal GST tagDepositorInsertdematin (DMTN Human)
TagsGlutatione-S-Tranferase and precision protease si…ExpressionBacterialMutationPEST sequence near the N-terminal removed. 5′-GCG…PromoterT7Available SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Neo1.e-Fc-His
Plasmid#72093PurposeExpresses the extracellular region of the Neogenin 1, isoform e protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-SNCAe3-A53T
Plasmid#85848PurposeDonor plasmid for SNCA exon3 A53T sequence. Also contains EGFP and tagBFPDepositorInsertSNCA exon 3 homology arms (SNCA Human)
ExpressionBacterial and MammalianAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmirGlo-CALB2-3'UTR delta ARE
Plasmid#74425PurposeCalb2 UTR with mutated AU binding sequenceDepositorAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
Plxnb1(S)-Fc-His
Plasmid#72127PurposeExpresses the N-terminal extracellular region of the PlexinB1 protein following proteolytic cleavage (ie, short), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.6-Fc-His
Plasmid#72103PurposeExpresses the extracellular region of the Neuropilin 2, isoform 6 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.2-Fc-His
Plasmid#72099PurposeExpresses the extracellular region of the Neuropilin 2, isoform 2 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.e-Fc-His
Plasmid#72114PurposeExpresses the extracellular region of the Netrin G1, isoform e protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.g-Fc-His
Plasmid#72116PurposeExpresses the extracellular region of the Netrin G1, isoform g protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.d-Fc-His
Plasmid#72113PurposeExpresses the extracellular region of the Netrin G1, isoform d protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only