We narrowed to 19,871 results for: Nov;
-
Plasmid#128853PurposeHigh copy number plasmid for expression of E. coli flagellin from a rhamnose-inducible promoterDepositorInsertFlagellin
ExpressionBacterialAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTone-gata2aECE-EGFP
Plasmid#132974Purposegata2a endothelial enhancer (x6) and basal promoter driving egfp in pTol1 backboneDepositorInsertseGFP
gata2a endothelial enhancer (x6) with a carp b-actin basal promoter
UseUnspecified; Transposon-mediatedAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pME-gata2a
Plasmid#132977Purposefull-length of gata2a without stop codon in pmE Gateway vectorDepositorInsertgata2a (gata2a Zebrafish)
UseGateway vectorAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-SOMA-T679A
Plasmid#118936PurposeUsed to express the T679A mutant form of the SOMA FRET sensor in E. coli.DepositorInsertSOMA FRET sensor for measuring MAPK activity in Arabidopsis thaliana with T679A Mutation
ExpressionBacterialAvailable SinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
gamma2 UTR3m shRNA
Plasmid#120797PurposeNegative control shRNA for plasmid 120796: shRNA targeting the 3'-untranslated region (UTR) of the gamma2 mRNADepositorInsertGABRG2 shRNA (Gabrg2 Rat)
UseRNAiAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAC-U61-SapI
Plasmid#112808PurposegRNA cloning vector for expressing 1-3 gRNAs in DrosophilaDepositorTypeEmpty backboneExpressionBacterialAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTGC-U6.3
Plasmid#112810PurposePCR template vector for amplifying gRNAcore-pU6.2 promoter fragmentDepositorInsertU6:3-gRNAcore
ExpressionBacterialAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
ORAI1-YFP V107M-L273D-L276D
Plasmid#114183PurposeORAI1 channel with C-terminal YFP, carrying the constitutively activating mutation V107M from TAM, and the mutations L273D-L276D leading to a deficiency in STIM1-mediated gating.DepositorInsertORAI1-YFP V107M-L273D-L276D (ORAI1 Human)
TagsYFPExpressionMammalianMutationV107M/L273D/L276DAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
ORAI1-YFP T184M-L273D-L276D
Plasmid#114184PurposeORAI1 channel with C-terminal YFP, carrying the activating mutation T184M from TAM, and the mutations L273D-L276D leading to a deficiency in STIM1-mediated gating.DepositorInsertORAI1-YFP T184M-L273D-L276D (ORAI1 Human)
TagsYFPExpressionMammalianMutationT184M/L273D/L276DAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET21a - Ec-ClpX D144L
Plasmid#111514PurposeExpresses E. coli ClpX with a C-terminal His tag and a mutation from D144 to L144DepositorInsertClpX
TagsHis tagExpressionBacterialMutationAspartatic acid 144 to LeucinePromoterT7Available SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR3-vsv-INCENP d543-746
Plasmid#108473Purposeexpression of vsv-INCENP d543-746DepositorInsertINCENP d543-746 AA (INCENP Human)
TagsVSVExpressionMammalianMutationDelta Alpha helix, aa543-746 deletedPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR3-vsv-dCEN-Incenp
Plasmid#108479Purposeexpression of vsv-dCEN-INCENPDepositorInsertdCEN-INCENP (INCENP Human)
TagsVSVExpressionMammalianMutationCEN box removedPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgPYM1
Plasmid#105249Purposehuman PYM1 sgRNADepositorInsertsgRNA for PYM1
ExpressionMammalianAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP1893-1
Plasmid#105248Purposehuman GFP11 with tagRFP 33bp downstream in Lamin A/C (recoded)DepositorInsertInsertion of GFP11 at cut tagRFP 33bp downstream (recoded *) in Lamin A/C (LMNA Human)
ExpressionBacterialAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-NSD3-short del(100-263)
Plasmid#72548Purposeexpresses 3*FLAG tagged human NSD3-short with 100-263 aa deletionDepositorInsertNSD3-short (NSD3 Human)
UseRetroviralTags3xFlag and SV40 NLSExpressionMammalianMutation100-263 aa deletionPromoterLTRAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET30Xa-SBL1(160E)
Plasmid#66846PurposeExpresses soybean lipoxygenase-1 S160E mutant with N-term HistagDepositorTagsHis-tagExpressionBacterialMutationS160EPromoterT7lacAvailable SinceSept. 16, 2015AvailabilityAcademic Institutions and Nonprofits only