We narrowed to 18,353 results for: multi
-
Plasmid#80652PurposePromoter1 with BCD21-gfpDepositorInsertGFP
UseP15a origin, constitutive promoter, kanrMutationNONEPromoterconstitutive promoterAvailable sinceAug. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTC151
Plasmid#70015PurposeTALENs targeting ANT1 locus, donor molecule with 5' homology arm-Pnos:NptII-35S:ANT13' homology arm as a non-replicating, mutant version of the Gemini Viral RepliconDepositorInsertNuclease (TALENs) + Donor + GVR
UseTALENExpressionPlantAvailable sinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMZ030
Plasmid#66970PurposeExpresses wild type zebrafish Chk1 with C-term GFP fluorescent tagDepositorInsertwildtype zebrafish Chk1
TagsGFPAvailable sinceNov. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
3x_a1gRNAOp_pCYC1m_yeBFP2
Plasmid#64391Purposeencodes three a1 operator sites upstream of minimal pCYC1 promoter driving yeast enhanced BFPDepositorPublicationInsertyeast enhanced BFP2
ExpressionYeastAvailable sinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
LIIc F 1-2 RNAi
Plasmid#54402DepositorTypeEmpty backboneUseCloning vectorAvailable sinceJuly 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
LII dy 1-3
Plasmid#54374DepositorInsertdummy 1-3
UseCloning vectorAvailable sinceJune 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
LII dy 2-6
Plasmid#54378DepositorInsertdummy 2-6
UseCloning vectorAvailable sinceJune 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
LII dy 4-5
Plasmid#54376DepositorInsertdummy 4-5
UseCloning vectorAvailable sinceJune 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
LII dy 2-3
Plasmid#54375DepositorInsertdummy 2-3
UseCloning vectorAvailable sinceJune 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTW2657
Plasmid#252577PurposeTRV2 multiplex vector expressing Ymu1-WFR, AtPDS3 gRNA12 and AtCHLl1 gRNA4DepositorInsertYmu1-WFR with AtPDS3 gRNA 12 and AtCHLl1 gRNA4
UseCRISPRExpressionPlantAvailable sinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGY214
Plasmid#239805PurposeExpress EGFP and mRFP1 simultaneously in filamentous fungiDepositorInsertsEGFP
mRFP1
UseFungal expressionPromoterTef1INAvailable sinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBP-Sparse.FRT10-p65.AD
Plasmid#232830PurposeEnhancer-free Sparse.FRT10 p65.AD with ccdB for GatewayDepositorInsertsFRT10-STOP-FRT10
p65.AD
ExpressionInsectAvailable sinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pD(Nt)_His6-SUMO
Plasmid#223879Purpose4G-cloning donor for N-terminal His6-SUMO tagDepositorInsertHis6-SUMO
UseGolden-gate donorAvailable sinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCIG-LRRC37B-HA
Plasmid#220792PurposeTo express the human receptor LRRC37B HA-tagged in mammalian cells together with EGFPDepositorInsertLRRC37B (LRRC37B Human)
TagsHAAvailable sinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-HA-deLACCO1-NGR
Plasmid#207990PurposeControl biosensor for extracellular L-lactateDepositorInsertdeLACCO1
UseAAVPromoterCaMKIIAvailable sinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLRD09
Plasmid#208261PurposeProduction of biformene in E. coli MEV20DepositorInsertscldB
cldD
ExpressionBacterialAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAXY0013
Plasmid#205582PurposeNpuDnaE(C)_HYG(53-341)_RUBYDepositorInsertNpuDnaE(C)
ExpressionPlantPromoter35SAvailable sinceOct. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
p10xUAS-WHaloCaMP1a-EGFP
Plasmid#205314PurposeExpression of WHaloCaMP1a-EGFP in Drosophila using GAL4 driverDepositorInsertWHaloCaMP1a-EGFP
ExpressionInsectAvailable sinceAug. 18, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTETDuet_WTDHFR_WTTS
Plasmid#191282PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationWT DHFR, WT TYMSPromoterT7 (folA), Tet (thyA)Available sinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only