168,241 results
-
Plasmid#17454Purpose3rd gen lentiviral Gateway destination vector, expression, CMV promoter, HygroDepositorTypeEmpty backboneUseLentiviral; Destination vectorExpressionMammalianAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only
-
pR26
Plasmid#127372PurposeAllows for doxycycline-inducible gene expression from the murine ROSA26 safe harbor locus upon CRISPR/Cas9-mediated genomic insertion and stable selection.DepositorTypeEmpty backboneUseCRISPR and Mouse TargetingPromotertight TRE promoterAvailable SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar3
Plasmid#232740PurposeExpresses NADPH/NADP+ biosensor NAPstar3 in S. cerevisiae.DepositorInsertNAPstar3
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRPN265NB-enh-MNase
Plasmid#166035PurposeExpresses a nanobody against GFP fused to micrococcal nuclease for purposes of green Cut & RunDepositorInsertGlutathione-S-Transferase/enhancer/MNase
TagsGSTExpressionBacterialPromoterlac promoter / tac promoterAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dCas13-NES-eNAT10
Plasmid#238299PurposeExpresses cytoplasmic version of the programmable RNA acetylation system.DepositorInsertdPspCas13b fused to eNAT10 (NAT10 Human, Prevotella sp. P5-125)
UseCRISPRTagsHIV NES (C terminal of dPspCas13b)ExpressionMammalianMutationH133A for catalytically inactive mutant, deletion…Available SinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBABE-puro-hTERT-HA
Plasmid#1772DepositorAvailable SinceJune 3, 2005AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT_HaloTag7-SNAP-tag2-NLS-P2A-NLS-mTurquoise2
Plasmid#226514PurposeMamalian cell expression of nuclear HaloTag7-SNAP-tag2 and nuclear mTurquoise2DepositorInsertHaloTag7-SNAP-tag2-NLS-P2A-NLS-mTurquoise2
ExpressionMammalianPromoterCMVAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
HIV-1 integrase F185K/C280S in pET-15b
Plasmid#61669PurposeHIV-1 integrase F185K/C280S in pET-15bDepositorInsertHIV-1 integrase F185K/C280S
UseSynthetic BiologyTagsHisPromoterT7 promotorAvailable SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiSSTe4_ChR2_mCherry (AAV PHP.eB)
Viral Prep#213945-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV_BiSSTe4_ChR2_mCherry (#213945). In addition to the viral particles, you will also receive purified pAAV_BiSSTe4_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the SST interneuron-targeting enhancer E4. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only