We narrowed to 16,280 results for: nes
-
Plasmid#69233PurposeR1335K mutant SpCas9 expression plasmid to clone TALEs through BbsI site (generates compatible overhangs with Acc65I and BamHI sites)DepositorInsertSpCas9
UseCRISPRTags2X NLS, BbsI TALE entry cassette, and NLS-3XHA-NL…ExpressionMammalianMutationArginine 1335 is changed to LysineAvailable sinceNov. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRevLCav2FeS
Plasmid#60808Purposeto disrupt iron sulfur cluster in yeast Rev3DepositorInsertREV3 (REV3 Budding Yeast)
ExpressionYeastMutationcontains 647 C-terminal amino acids and 335 bp of…Available sinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
HA-L-SA-2A-NeoR-CAG-M2rtTA-Cas9-TRE-HA-R
Plasmid#258168PurposeDNA template for insertion of doxycycline inducible Cas9 and constitutively active M2rtTA expression cassettes into human AAVS1 siteDepositorInsertSpCas9
TagsFlag taggedExpressionMammalianPromoterTREAvailable sinceJuly 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
p_sc-eVIP-delta-Puro-EGFP-NFKB2
Plasmid#249467PurposeTransfer plasmid for stable transgene expression with 2nd or 3rd generation lentiviral systemsDepositorAvailable sinceJune 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
p_sc-eVIP-delta-puro-EGFP-ACKR3-R161C
Plasmid#249439PurposeTransfer plasmid for stable transgene expression with 2nd or 3rd generation lentiviral systemsDepositorAvailable sinceJune 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
p_sc-eVIP-delta-Puro-EGFP-BRAF-V600E
Plasmid#249448PurposeTransfer plasmid for stable transgene expression with 2nd or 3rd generation lentiviral systemsDepositorAvailable sinceJune 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
p_sc-eVIP-delta-Puro-EGFP-BRAF-N581S
Plasmid#249447PurposeTransfer plasmid for stable transgene expression with 2nd or 3rd generation lentiviral systemsDepositorAvailable sinceJune 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
p_sc-eVIP-delta-Puro-EGFP-NRAS-Q61K
Plasmid#249471PurposeTransfer plasmid for stable transgene expression with 2nd or 3rd generation lentiviral systemsDepositorAvailable sinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
p_sc-eVIP-delta-Puro-EGFP-NRAS-G12D
Plasmid#249470PurposeTransfer plasmid for stable transgene expression with 2nd or 3rd generation lentiviral systemsDepositorAvailable sinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAG-HA-NL2/1dWW-RM IRES mCherry
Plasmid#249597PurposeExpress NL2 - NL1 chimera, mutating amino acids 779-782 (PPDY -> AAAA), resistant to shRNA (RM)DepositorInsertNlgn2 (Nlgn2 Mouse)
TagsHAExpressionMammalianMutationChimeric protein of NL2 extracellular domain, wit…Available sinceJune 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA075 Cas9-BFP-HBB_IVS2
Plasmid#249136PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 3' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9-TagBFP-HBB_IVS2 (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA072 Cas9-HBB_IVS2-BFP
Plasmid#249133PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron after Cas9 coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9-HBB_IVS2-TagBFP (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA099 PGK1_IVS3-Cas9-BFP
Plasmid#249149PurposeOverexpression of SpCas9-BFP with PGK1 IVS3 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertPGK1_IVS3-Cas9-TagBFP (PGK1 S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationPGK1 IVS3 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA096 PSMD4_IVS6-Cas9-BFP
Plasmid#249146PurposeOverexpression of SpCas9-BFP with PSMD4 IVS6 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertPSMD4_IVS6-Cas9-TagBFP (PSMD4 S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationPSMD4 IVS6 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT5G42080-mKOk
Plasmid#224852PurposePlasmid for expression of AT5G40280.1 coding sequence tagged with mKOk in plantsDepositorInsertAT5G40280.1 (ERA1 Mustard Weed)
ExpressionPlantAvailable sinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cas9-T2A-H2B mCitirine
Plasmid#210471PurposeCoexpression of Cas9 and H2B mCitrineDepositorInsertCas9-T2A-H2B mCitirine
UseCRISPR and Synthetic BiologyTagsmCitrine on C terminal of H2BExpressionMammalianMutationCas9 contains 3xFLAG tag and nuclear localization…Available sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Donor_N_FH_Piwi
Plasmid#186651PurposeDonor plasmid to endogenously tag piwi gene in Drosophila melanogaster ovarian somatic sheet (OSS) cells.DepositorInsertOSS PIWI N-terminal 3xFlag-3xHA Tag Donor Plasmid (piwi Fly)
Tags3xFlag-3xHAExpressionInsectAvailable sinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only