We narrowed to 14,473 results for: cas9 genes
-
Plasmid#166102PurposeThis plasmid express a sgRNA that targets the IDH2 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH2-135 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pROS13_IDH1 #4
Plasmid#166101PurposeThis plasmid express a sgRNA that targets the IDH1 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH1-67 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRDA_052
Plasmid#136474PurposeLentiviral expression of AsCas12a gRNADepositorInsertPuromycin resistance
UseLentiviral and Synthetic BiologyPromoterEF1aAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti NG-ABE8e_P2A_GFP + PuroR
Plasmid#242000PurposeLentiviral plasmid for generation of cell lines stably expressing NG-ABE8e base editor. NG-ABE8e expression can be followed by GFP fluorescence. Contains PGK-puromycin resistance cassette.DepositorInsertNG-ABE8e
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
px-458-sgRNA-scramble
Plasmid#206924PurposePlasmid expressing Cas9, GFP and non-targeting guides for using as a control in CRISPR experimentsDepositorInsertnon-targeting human sgRNA guides
UseCRISPRPromoterU6Available SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
px459-TDP-43 sgRNA1
Plasmid#133762PurposeExpresses Cas9 and human TDP-43 sgRNADepositorAvailable SinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
px459-TDP 43 sgRNA2
Plasmid#133763PurposeExpresses Cas9 and human TDP-43 sgRNADepositorAvailable SinceJan. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGE347
Plasmid#153228PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGE651
Plasmid#153229PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
dCBE4-gam
Plasmid#124449PurposeExpresses dead Cas9 (dCas9)-CBE4-gamDepositorInsertdCBE4-gam
UseCRISPR and Synthetic BiologyExpressionMammalianMutationD10A, H840AAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDGE666
Plasmid#153231PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRTagsGFPExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1 sgTollip
Plasmid#196546PurposeLentiviral CRISPR-Cas9 plasmid containing gRNA targeting exon 1 of human Tollip. Used for generation of Tollip protein knockouts in human cell lines.DepositorAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
PXPR007 sgGFP-1
Plasmid#74960PurposeCas9 + sgGFP-1 with blasticidin selectionDepositorInsertGFP
UseCRISPRExpressionMammalianAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDGE668
Plasmid#153233PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRTagsGFPExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
BPK1179
Plasmid#179296PurposeExpresses dCas9 fused to four DmrA domainsDepositorInsertdCas9-DmrA(x4)
ExpressionMammalianMutationD10A, H840A (catalytically inactive Cas9)PromoterCAGAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDGE667
Plasmid#153232PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRTagsGFPExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBTK615
Plasmid#110609PurposeBTK assembled plasmid - used in Stage 2 assembly to target Cas9 or dCas9DepositorInsertsgRNA
UseSynthetic BiologyAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGE652
Plasmid#153230PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_pCMV-nCas-PmCDA1 pH1-gRNA(HPRT)
Plasmid#79619PurposeExpresses nCas9-PmCDA1 and gRNA(HPRT) in mammalian cellsDepositorInsertSpCas9
Tags3xFlag-PmCDA1ExpressionMammalianMutationD10A for nickase Cas9PromoterpCMVAvailable SinceJuly 27, 2016AvailabilityAcademic Institutions and Nonprofits only