We narrowed to 34,670 results for: CAT
-
Plasmid#161091PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC7A1 (SLC7A1 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV-PGK-DIO-mCherry-TLR4miR-TLR2miR
Plasmid#137733PurposeLentivirus vector for TLR2/4 miR in a Cre-dependent mannerDepositorInsertTKR2/4 microRNA
UseLentiviralTagsmChherryExpressionMammalianAvailable SinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pet28a-ClbB-NRPS-NHis
Plasmid#49217PurposeNRPS module of ClbB containing CAT domains with N-terminal 6His tagDepositorInsertClbB-NRPS
Tags6x His tag and T7 tagExpressionBacterialMutationcontains aa4-1080 of reference sequence NP_754362…PromoterT7Available SinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pIOM17
Plasmid#20870DepositorInsertaphA::cat
ExpressionBacterialAvailable SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL5
Plasmid#72989PurposeRBS_M2DepositorInsertM2 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL11
Plasmid#72995PurposeRBS_L4DepositorInsertL4 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL4
Plasmid#72988PurposeRBS_H5DepositorInsertH5 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL8
Plasmid#72992PurposeRBS_L1DepositorInsertL1 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-L1U1H09
Plasmid#73008PurposeL1U1H09 terminatorDepositorInsertL1U1H09 terminator
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TB
Plasmid#48656PurposeBacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TA
Plasmid#48651PurposeBacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TA
Plasmid#48655PurposeBacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TB
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TB
Plasmid#48652PurposeBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TA
Plasmid#48649PurposeBacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL6
Plasmid#72990PurposeRBS_M3DepositorInsertM3 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL7
Plasmid#72991PurposeRBS_M5DepositorInsertM5 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL9
Plasmid#72993PurposeRBS_L2DepositorInsertL2 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only