We narrowed to 16,593 results for: grna
-
Plasmid#207910PurposeLevel 0 for gRNA in C2 module (5' AGCC-3' TTCG)DepositorInsertpU3-AarI-scaffold-term
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS019
Plasmid#207913PurposeLevel 0 for gRNA in D1 module (5' TCAG-3' TGAC)DepositorInsertpU6-AarI-scaffold-term
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-P19-EGFP
Plasmid#196609PurposesiRNA vector expressing TMV P19 and a 720-long EGFP sequence as inverted repeatDepositorInsertp19 + EGFP inverted repeat sequence
Tags6x His tagExpressionBacterialPromoterAraCAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-sgHPRT1
Plasmid#196713PurposeCRISPR-KO. WT-SpCas9 and sgRNA targeting HPRT1. Editing-competent cells can be selected with 6-TGDepositorInsertCas9-T2A-BSD-U6-sgHPRT1
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSPromoterEF1a/hU6Available SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-U6-sgGFP
Plasmid#190899PurposeAAV vector expressing sgGFPDepositorInsertsgRNA
UseAAV and CRISPRPromoterU6Available SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
p8271 LentiCRISPR v2 hygro sgSIGIRR-4
Plasmid#193980PurposeExpression of spCas9 and sgRNA targeting SIGIRRDepositorInsertspCas9 and sgRNA targeting SIGIRR (SIGIRR Human)
UseLentiviralAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV:AsCpf1-2A-GFP-U6-MAFB-sg
Plasmid#194718PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that target hMAFBDepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB1839
Plasmid#193103PurposeGB-cassette for the expression of guide RNA targeting the DFR promoter in -376 position (gRNA2), with 2.1 Ms2 aptamer in the 3' of the scaffold.DepositorInsertGB_SynP gRNA2
UseSynthetic BiologyAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCK411.RR1
Plasmid#192644PurposeExpresses sgRNA RR1 (target mRFP CDS) on ColE1-AmpRDepositorInsertBBa_J23119-RR1
UseCRISPR and Synthetic BiologyPromoterBBa_J23119Available SinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Prdm14-L5-#1
Plasmid#171513Purposedeletion of a genomic locus in Prdm14 geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Prdm14-L5-#2
Plasmid#171514Purposedeletion of a genomic locus in Prdm14 geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Prdm14-ex1-#1
Plasmid#171507Purposedeletion of a genomic locus in Prdm14 geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Prdm14-ex1-#2
Plasmid#171508Purposedeletion of a genomic locus in Prdm14 geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Prdm14-L3-#1
Plasmid#171509Purposedeletion of a genomic locus in Prdm14 geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Prdm14-L3-#2
Plasmid#171510Purposedeletion of a genomic locus in Prdm14 geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Prdm14-L4-#1
Plasmid#171511Purposedeletion of a genomic locus in Prdm14 geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Prdm14-L4-#2
Plasmid#171512Purposedeletion of a genomic locus in Prdm14 geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato166/892
Plasmid#179919PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 166 and 892.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX552-mScn8a-3xHA-Syn-smFP-flag
Plasmid#182563PurposeFor mouse Nav1.6 knockin with 3xHA at the C-terminalDepositorInsertsmouse Scn8a gRNA and 3xHA donor DNA
smFP-flag
UseAAV and CRISPRPromoterEF1 and U6Available SinceMarch 28, 2022AvailabilityAcademic Institutions and Nonprofits only