We narrowed to 12,273 results for: shRNA

#169282

Doxycycline-inducible overexpression of miRNA or shRNA with dTomato as a reporter fluorescent protein

Dirk Heckl

July 19, 2021

Academic Institutions and Nonprofits only

#169281

Constitutive overexpression of miRNA or shRNA with mTagBFP2 as reporter fluorescent protein

Dirk Heckl

July 19, 2021

Academic Institutions and Nonprofits only

#186714

Expresses dox-controlled miR-E shRNAs (UT4GEPIR). Multi-miR shRNAs targeting A-RAF, B-RAF, and C-RAF (shABC2 = shARAF.169-shBRAF.1296-shCRAF.387). The shABC2 set is better than shABC1.

Christof Fellmann

Amen et al Cell Rep Methods. 2022 Jun 21;2(7):10023

Jan. 20, 2023

Academic Institutions and Nonprofits only

#186713

Expresses dox-controlled miR-E shRNAs (UT4GEPIR). Multi-miR shRNAs targeting A-RAF, B-RAF, and C-RAF (shABC1 = shARAF.381-shBRAF.2015-shCRAF.2446). The shABC2 set is better than shABC1.

Christof Fellmann

Amen et al Cell Rep Methods. 2022 Jun 21;2(7):10023

Oct. 31, 2022

Academic Institutions and Nonprofits only

#11344

Guy Caldwell

May 25, 2006

Academic Institutions and Nonprofits only

#127696

Doxycyclin inducible pTRIPZ lentivirus vector containing a non-silencing sequence for both human and mouse

Sandra Demaria

Vanpouille-Box et al Nat Commun. 2017 Jun 9;8:15618. doi: 10.

Nov. 1, 2019

Academic Institutions and Nonprofits only

#14763

Tyler Jacks

Kumar et al Nat Genet. 2007 May;39(5):673-7. doi: 10

April 5, 2007

Academic Institutions and Nonprofits only

#59360

Lentiviral expression vector: p53 shRNA under control of mouse U6 promoter, EGFP-expression driven by CAG promoter to monitor expression.

Peter Scheiffele

Chih et al Science. 2005 Feb 25;307(5713):1324-8. E

July 21, 2015

Academic Institutions and Nonprofits only

#136038

G3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)

Anthony Leung

Fischer et al Mol Cell. 2020 Apr 2;78(1):70-84.e6. doi

Feb. 4, 2020

Academic Institutions and Nonprofits only