We narrowed to 15,952 results for: grna
-
Plasmid#173663PurposeVector with BaeI site to allow cloning of custom sgRNA into vector containing Cre-recombinaseDepositorInsertBaeI site
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
petRNA-FANCF-v3'
Plasmid#181803PurposepetRNA FANCF v3'DepositorInsertribozyme-petRNA
UseCRISPRAvailable SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-mtIF3 shRNA_TagRFP657
Plasmid#182367PurposeshRNA targeting mtIF3 mRNADepositorAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shControl
Plasmid#180386PurposeProducing AAV that encodes negative control shRNA with miR-E backboneDepositorInsertshControl
UseAAV and RNAiPromoterCBAAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_LMNA_G2
Plasmid#178090PurposeExpresses the LMNA G2 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with LMNA_mScarlet-I_Donor to tag LMNA with mScarlet-I. pX330-like plasmid.DepositorInsertLMNA G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6nH1-HD10kb
Plasmid#172657PurposeExpressing paired pegRNAs from human U6 and H1 promoters to make 10204-bp deletion on HPRT1 geneDepositorInsertpegRNA-HD10kbA/pegRNA-HD10kbB
UseCRISPRAvailable SinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAT15415-BEAR-GFP-target-mCherry
Plasmid#162995Purposeplasmid expressing an sgRNA targeting the BEAR-GFP plasmid along with an mCherry markerDepositorInsertsgRNA targeting the BEAR-GFP plasmid
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgCtrl#1
Plasmid#174142PurposeLentiviral vector expressing a control sgRNA that targets a safe harbor siteDepositorInsertControl sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_AMBRA1#1
Plasmid#174152PurposeLentiviral vector expressing Cas9 and a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMCB619
Plasmid#171011PurposeCRISPR sgRNA vector (puro-BFP with BstXI/BlpI digest sites).DepositorInsertU6:sgRNA_Puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSuper-gmiR-124
Plasmid#171555Purposea human miR-124-expressing plasmidDepositorInsertmiR-124 (MIR124-1 Human)
ExpressionMammalianAvailable SinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHSG1C3
Plasmid#164423Purposesingle guide RNA (sgRNA) and Prime editing guide RNA (pegRNA) cloning and mammalian cell expression. BbsI cloning for sgRNAs and BbsI/PstI for pegRNAs.DepositorInsertsgRNA
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
GluA3 (px330:2-guideCas9)
Plasmid#169424PurposeExpression of Cas9 and 2 guidesDepositorInsertspCas9
UseCRISPRExpressionMammalianAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-KLF7-1
Plasmid#169797PurposeExpresses Cas9 and guide RNA for the site neighbouring KLF7 gene.DepositorInsertguide RNA for KLF7 neighbouring region
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CSAC-Bmal1
Plasmid#168296PurposeExpresses sgRNA in mammalian cellsDepositorInserthU6-sgBmal1-1-hU6-sgBmal1-3
UseAAVTagsmCherryPromoterU6, hSynAvailable SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
p8103 LentiCRISPR v2 sgNT-2
Plasmid#163313PurposeExpresses Cas9 and a non-targeting control guide RNADepositorInsertsgNT-2
UseCRISPR and LentiviralPromoterU6Available SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-GFP-miRE_shRen-Blast
Plasmid#135682PurposeConstitutive expression (EF1a promoter) of GFP cDNA plus miRE-embedded shRenilla (control shRNA), Blasticidin selectionDepositorInsertshRenilla
UseLentiviralAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR CDS
Plasmid#110411PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgACSL4 clone2
Plasmid#162129PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgACSL4 clone1
Plasmid#162128PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only