We narrowed to 22,848 results for: TES
-
Plasmid#138579PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17918617_17920400DepositorAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pGL4.24-Cd36-enhancer6
Plasmid#138578PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17898458_17899478DepositorAvailable SinceMay 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4.24-Cd36-enhancer3
Plasmid#138575PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17848003_17849903DepositorAvailable SinceMay 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4.24-Cd36-enhancer2
Plasmid#138574PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17843052_17844983DepositorAvailable SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-VprBP (C590)
Plasmid#133589PurposeExpresses human VprBP C590 mutant in mammalian cellsDepositorInsertVpr (HIV-1) binding protein (DCAF1 Human)
TagsHAExpressionMammalianMutationC590 mutation of human VprBP lacking the N-termin…Available SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
PGEX-6P1-hNF2-AR mutant
Plasmid#107149Purposebacterial expressionDepositorAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pETM33_CEP55_EABR
Plasmid#178469PurposeBacterial expression of human domain with His-tag and GST tagDepositorAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cry2 mCherry PGK-1 in pcDNA3.1
Plasmid#64214PurposemCherry fused between Cry2 and PGK-1 to study cell migrationDepositorTagsmcherryExpressionMammalianPromoterCMVAvailable SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRVdGL-1EGFP
Plasmid#98036PurposeSecond-generation rabies viral vector genomeDepositorInsertEGFP
ExpressionMammalianPromoterCMVAvailable SinceMarch 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
AfrLEA3m_mCh-2xFKBP (pBS1137)
Plasmid#185321PurposeFor the mammalian expression of the brine shrimp protein AfrLEA3m attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertAfrLEA3m
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_APOE_HUMAN_E4_47-300 (pBS0847)
Plasmid#185279PurposeFor the mammalian expression of the human protein APOE_HUMAN_E4_47-300. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertAPOE_HUMAN_E4_47-300
ExpressionMammalianAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-1: shALAS-1
Plasmid#22750DepositorAvailable SinceDec. 3, 2009AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 dSAP
Plasmid#68830PurposeExpresses c-myc-tagged human RAD18 deleting SAP domainDepositorInsertc-myc tagged human RAD18 deleting SAP domain (RAD18 Human)
Tagsc-mycExpressionMammalianPromoterCAGAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-MUC2 D1D2D'D3 with cleavable His tag
Plasmid#187994PurposeExpresses MUC2 D1D2D'D3 assembly with cleavable His tag in mammalian cellsDepositorInsertmucin2 D1D2D'D3 (MUC2 Human)
Tags6xHistadine followed by TEV cleavage siteExpressionMammalianPromoterCMVAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4-Cluster Promoter Delta 1
Plasmid#100126PurposeIt contains ~1.4Kb of the miR-183/96-182 cluster promoterDepositorInsertmiR-183-96-82 Cluster promoter (MIR182 Human)
UseLuciferaseAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-Ku70siR-Mut6E
Plasmid#46962PurposeFor constitutive or doxycycline-inducible expression of mutant human Ku70 unable to bind DNA and resistant to siRNA. Confers resistance to puro. Use T-REx cells for doxycycline-inducible expression.DepositorInsertKu70 (XRCC6 Human)
TagsGFP-FLAGExpressionMammalianMutationMut6E corresponding to K282E K287E T300E K331E K3…PromoterCMV TetAvailable SinceAug. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 dC2
Plasmid#68831PurposeExpresses c-myc-tagged human RAD18 deleting Polymerase eta binding domainDepositorInsertc-myc tagged human RAD18 deleting Polymerase eta binding domain (RAD18 Human)
Tagsc-mycExpressionMammalianPromoterCAGAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mqgDUX4
Plasmid#21176DepositorInsertDUX4 (DUX4 Human)
ExpressionBacterial and MammalianAvailable SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pShuttle-EGFP-CLASP2 340-1084
Plasmid#24383DepositorInsertCLASP2 (340-1084) (CLASP2 Human)
UseAdenoviralTagsEGFPExpressionMammalianMutationCLASP2 deletion mutant that retains MT lattice bi…Available SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only