-
Plasmid#50834PurposeAn AAV packaging vector that expresses channel rhodopsin 2 (H134R) (fused to EYFP) under the EF1a promoter, which can be deactivated (deleted) by recombination between the flanking loxP sites.DepositorInserthChR2 (H134R)
UseAAV and Cre/LoxTagsEYFPExpressionMammalianMutationH134RPromoterEF1aAvailable sinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1784 - pAAV SYN1 hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201820PurposeAn adeno-associated viral vector expressing channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a synapsin promoter, for use in PET imagingDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVTagsExpressionMutationPromoterSYN1Available sinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1619 pAAV SYN1 Nuc-EYFP miR-30 SST
Plasmid#135565PurposeAn AAV vector expressing miR-30a shRNA vs rat SOM (aka SST) and a nuclear EYFP reporterDepositorInsertsmiR-30 rat SST
Nuc-EYFP
UseAAVTags3xNLSExpressionMammalianMutationPromoterSYN1 and hSYN1Available sinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1179 - pAAV (flox-stop) TH gRNA A EF1a eGFP
Plasmid#113158PurposeAn AAV vector that expresses a Cre-dependent guide RNA targeting rat TH and expresses EGFP reporterDepositorInsertgRNA for rat TH
UseAAV, CRISPR, and Cre/LoxTagsExpressionMammalianMutationPromotermU6Available sinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1618 pAAV SYN1 Nuc-EYFP miR-30 FF3
Plasmid#135564PurposeAn AAV vector expressing miR-30a shRNA vs FF luciferase and a nuclear EYFP reporterDepositorInsertsmiR-30 FF3
Nuc-EYFP
UseAAVTags3xNLSExpressionMammalianMutationPromoterSYN1 and hSYN1Available sinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2ExpressionMutationPromoterEF1a, hU6, and mU6Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1845 - pAAV CaMKII hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201822PurposeAn adeno-associated viral vector expressing channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a CaMKii promoter, for use in PET imagingDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVTagsExpressionMutationPromoterCaMKiiAvailable sinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1664 - pAAV SYN1 mGas6(delta)-Myc-DDK
Plasmid#202541PurposeAn adeno-associated viral vector expressing murine Gas6 with deletion of (F50-E275) fused Myc and DDK epitopes from a synapsin promoterDepositorInsertGas6 (Gas6 Mouse)
UseAAVTagsMyc-DDKExpressionMutationDeletion of F50-E275PromoterSYN1Available sinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1584 - pscAAV CMV-IE secreted EGFP-THPKTEL WPRE
Plasmid#188539PurposeAn AAV packaging vector that expresses secreted C-CDNF under control of the EGFP promoter.DepositorInsertsecreted EGFP
UseAAVTagsCDNF(1-28) and THPKTEL WPREExpressionMutationPromoterCMV-IEAvailable sinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH270-Tier1-OTtgO2-PCMVmin2-SEAP-p2A-iRFP670
Plasmid#169592PurposeTier-1 vector encoding PTtgO2-driven SEAP-p2A-iRFP670 expression (OTtgO2-PCMVmin-2-SEAP-p2A-iRFP670-pA).DepositorInsertphloretin-controlled SEAP and iRFP expression
UseTagsExpressionMammalianMutationPromoterTtgO2-PCMVmin-2Available sinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1534 pscAAV mU6 shRNA(PKCd) CMV-IE Nuc-EYFP
Plasmid#135562PurposeAn AAV vector expressing shRNA vs rat PKCd and a nuclear EYFP reporterDepositorInsertsshRNA (mouse PKCd)
Nuc-EYFP
UseAAV and RNAiTags3xNLSExpressionMammalianMutationPromoterCMV-IE and mU6Available sinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH
Plasmid#131683PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHExpressionMutationPromoterEF1a and mU6Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1822 - pAAV SYN1 DIO hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201821PurposeAn adeno-associated viral vector expressing Cre-dependent channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a synapsin promoter, for use in PETDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVTagsExpressionMutationPromoterSYN1Available sinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1535 pscAAV mU6 shRNA(scram) CMV-IE Nuc-EYFP
Plasmid#135563PurposeAn AAV vector expressing scrambled shRNA and a nuclear EYFP reporterDepositorInsertsshRNA (scrambled)
Nuc-EYFP
UseAAV and RNAiTags3xNLSExpressionMammalianMutationPromoterCMV-IE and mU6Available sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1596 - pAAV SYN1 HA-hM3D(Gq) (AAV5)
Viral Prep#121539-AAV5PurposeReady-to-use AAV5 particles produced from pOTTC1596 - pAAV SYN1 HA-hM3D(Gq) (#121539). In addition to the viral particles, you will also receive purified pOTTC1596 - pAAV SYN1 HA-hM3D(Gq) plasmid DNA. Synapsin-driven, HA-tagged hM3D(Gq) for neuronal activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsHAAvailable sinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1596 - pAAV SYN1 HA-hM3D(Gq) (AAV2)
Viral Prep#121539-AAV2PurposeReady-to-use AAV2 particles produced from pOTTC1596 - pAAV SYN1 HA-hM3D(Gq) (#121539). In addition to the viral particles, you will also receive purified pOTTC1596 - pAAV SYN1 HA-hM3D(Gq) plasmid DNA. Synapsin-driven, HA-tagged hM3D(Gq) for neuronal activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsHAAvailable sinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1484 - pAAV SYN1 HA-hM4D(Gi) (AAV2)
Viral Prep#121538-AAV2PurposeReady-to-use AAV2 particles produced from pOTTC1484 - pAAV SYN1 HA-hM4D(Gi) (#121538). In addition to the viral particles, you will also receive purified pOTTC1484 - pAAV SYN1 HA-hM4D(Gi) plasmid DNA. Synapsin-driven, HA-tagged hM4D(Gi) for neuronal inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsHAAvailable sinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1484 - pAAV SYN1 HA-hM4D(Gi) (AAV5)
Viral Prep#121538-AAV5PurposeReady-to-use AAV5 particles produced from pOTTC1484 - pAAV SYN1 HA-hM4D(Gi) (#121538). In addition to the viral particles, you will also receive purified pOTTC1484 - pAAV SYN1 HA-hM4D(Gi) plasmid DNA. Synapsin-driven, HA-tagged hM4D(Gi) for neuronal inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsHAAvailable sinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV5)
Viral Prep#112677-AAV5PurposeReady-to-use AAV5 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)Available sinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV1)
Viral Prep#112677-AAV1PurposeReady-to-use AAV1 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)Available sinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only