We narrowed to 9,771 results for: crispr plasmids
-
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_MET16
Plasmid#166091PurposePlasmid for constituive spCas9 and tet-inducible MET16 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceMay 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP1
Plasmid#166103PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombination.DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_CPR1_1
Plasmid#166074PurposePlasmid for constituive spCas9 and tet-inducible CPR1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RRT8
Plasmid#166080PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RRT8 for double stranded break formation in yeast.DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_CPR1_2
Plasmid#166071PurposePlasmid for constituive spCas9 expression and tet-inducible expression of an sgRNA targeting an intergenic site near CPR1 for double stranded break formation in yeast.DepositorInsertIntergenic region near CPR1
UseCRISPRExpressionYeastPromoterTet-inducibleAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_GAL7
Plasmid#166089PurposePlasmid for constituive spCas9 and tet-inducible GAL7 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_GLK1
Plasmid#166090PurposePlasmid for constituive spCas9 and tet-inducible GLK1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_LHS1
Plasmid#166092PurposePlasmid for constituive spCas9 and tet-inducible LHS1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RPL22A
Plasmid#166079PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RPL22A for double stranded break formation in yeast.DepositorAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_YBL055C
Plasmid#166077PurposePlasmid for constituive spCas9 and tet-inducible YBL055C targeting sgRNA expression for double stranded break formation in yeastDepositorInsertYBL055C (near PTC3) (YBL055C Budding Yeast)
UseCRISPRExpressionYeastPromoterTet-inducibleAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_YNR071C
Plasmid#166081PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of YNR071C for double stranded break formation in yeast.DepositorInsertPromoter of YNR071C (YNR071C Budding Yeast)
UseCRISPRExpressionYeastPromoterTet-inducibleAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_SLA1
Plasmid#166075PurposePlasmid for constituive spCas9 and tet-inducible SLA1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_PDR12
Plasmid#166093PurposePlasmid for constituive spCas9 and tet-inducible PDR12 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_TDH2
Plasmid#166082PurposePlasmid for constituive spCas9 and tet-inducible TDH2 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_LYS9
Plasmid#166085PurposePlasmid for constituive spCas9 and tet-inducible LYS9 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only