We narrowed to 25,363 results for: nes
-
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5K85R-VA
Plasmid#98691PurposeLentiviral expression of human PRDX5-K85R in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationK85RPromoterCMVAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5E80K-VA
Plasmid#98689PurposeLentiviral expression of human PRDX5-E80K in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationE80KPromoterCMVAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5K83R-VA
Plasmid#98690PurposeLentiviral expression of human PRDX5-K83R in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationK83RPromoterCMVAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1a-BbChT (AAV9)
Viral Prep#45186-AAV9PurposeReady-to-use AAV9 particles produced from AAV-EF1a-BbChT (#45186). In addition to the viral particles, you will also receive purified AAV-EF1a-BbChT plasmid DNA. Brainbow construct encoding mCherry and mTFP, both in reverse orientation between mutant Lox sites. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry, mTFP, or noneAvailable SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn_WiChR_TS_mScarlet_ER (AAV9)
Viral Prep#205997-AAV9PurposeReady-to-use AAV9 particles produced from pAAV_hSyn_WiChR_TS_mScarlet_ER (#205997). In addition to the viral particles, you will also receive purified pAAV_hSyn_WiChR_TS_mScarlet_ER plasmid DNA. hSyn-driven K+ selective channelrhodopsin for optogenetic inhibition of neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmScarletAvailable SinceJuly 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP1636 - pAAV-AiE2116m-minBG-iCre-WPRE-BGHpA (AAV5)
Viral Prep#230681-AAV5PurposeReady-to-use AAV5 particles produced from AiP1636 - pAAV-AiE2116m-minBG-iCre-WPRE-BGHpA (#230681). In addition to the viral particles, you will also receive purified AiP1636 - pAAV-AiE2116m-minBG-iCre-WPRE-BGHpA plasmid DNA. minBG-driven expression of iCre recombinase in specific populations of brain cells. These AAV preparations are suitable purity for injection into animals.DepositorPromoterminBGAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP11839-pAAV-hSyn1-SYFP2-10aa-H2B-WPRE3-BGHpA (Alias: CN1839) (AAV PHP.eB)
Viral Prep#163509-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from AiP11839-pAAV-hSyn1-SYFP2-10aa-H2B-WPRE3-BGHpA (Alias: CN1839) (#163509). In addition to the viral particles, you will also receive purified AiP11839-pAAV-hSyn1-SYFP2-10aa-H2B-WPRE3-BGHpA (Alias: CN1839) plasmid DNA. hSyn1-driven expression for nuclear SYFP2 labeling in neurons. Useful for nuclear isolation and scRNA-seq applications. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsSYFP2Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiP11390-pAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA (Alias: CN1390) (AAV PHP.eB)
Viral Prep#163505-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from AiP11390-pAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA (Alias: CN1390) (#163505). In addition to the viral particles, you will also receive purified AiP11390-pAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA (Alias: CN1390) plasmid DNA. AAV vector for strong and rapid SYFP2 expression in forebrain GABAergic interneurons. The enhancer core sequence has 100% sequence conservation between mouse and human. Developed especially for rapid viral labeling in human and NHP organotypic brain slice culture. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterminBetaGlobinTagsSYFP2Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLSC-5
Plasmid#62889PurposeLenti vector for expression of inducible split Cas9DepositorInsertsSpCas9(574-1368)
SpCas9(2-573)
UseCRISPR and LentiviralTagsFFBP12, FRB, NES PTK2, NLS SV40, and P2AExpressionMammalianMutation*see comment belowPromoterEFSAvailable SinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cyto-GCaMP3
Plasmid#64853PurposeCytosol-targeted version of the Ca2+ indicator GCaMP3.DepositorInsertGCaMP3
TagsNuclear export signal (NES)ExpressionMammalianPromoterCMVAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pmax-3xFLAG_3xNLS_dPspCas13b(AAAA)_2xNLS-Clover
Plasmid#196829PurposeExpress dpdpCas13b with AAAA mutation and CloverDepositorInsertdpspCas13b(AAAA)
Tags3XFLAG and NESExpressionMammalianMutationK367A, D369A and K370AAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTL
Plasmid#203176PurposeCentromeric yeast expression vector, leucine selectionDepositorTypeEmpty backboneExpressionYeastAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-Cyto-CaNARi
Plasmid#64849PurposeCytosol-targeted FRET biosensor for monitoring calcineurin (CaN) activation.DepositorInsertCaNARi
TagsCerulean, Nuclear export signal (NES), and VenusExpressionMammalianPromoterCMVAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
MCP-ADAR2-DD
Plasmid#170124PurposeLentiviral vector carrying the MCP-ADAR2 with a nuclear export signalDepositorInsertMCP-ADAR2-DD-NES
UseLentiviralExpressionMammalianPromoterEf1a core promoterAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAV0479
Plasmid#133499PurposeExpression of sfGFP excluded from the nucleus with two NES signalsDepositorInsertpHis5(StuI)-p(tdh1)-NESwis1-sfGFP-NESmia1-natMX
ExpressionYeastAvailable SinceNov. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pQP-NiRISB
Plasmid#138977PurposeLight-controlled tri-directional targeting of endogenous proteins (nucleus-shifted)DepositorInsertNcoI-BphP1-CAAX-IRES2-NES- iB(GFP)- mCherry-Q-PAS1-AsLOV2cNLS-NotI
Available SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
Split-RESCUE-C
Plasmid#170154PurposeAAV vector carrying the RESCUE-DDC-λN (RESCUE is the evolved ADAR2 variant for C-U editing) with a nuclear export signalDepositorInsertRESCUE-DDC-λN-NES
UseAAVExpressionMammalianPromoterCMVAvailable SinceJan. 27, 2023AvailabilityAcademic Institutions and Nonprofits only