We narrowed to 1,983 results for: aav vector plasmid
-
Plasmid#59968PurposeAn AAV packaging vector that expresses catalytically-inactive hPREP under control of the EF1a promoter.DepositorInsertProlyl oligopeptidase (PREP Human)
UseAAVTagsExpressionMammalianMutationS554APromoterEF1aAvailable sinceOct. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MPRA-MluI-SpeI-EcoRI
Plasmid#190196PurposeEmpty vector for inserting MPRA libraries into AAVDepositorTypeEmpty backboneUseAAV; Massively parallel reporter assay (mpra)TagsExpressionMammalianMutationPromoterAvailable sinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
vDip-C: pAAV-Pcp2-mGreenLantern-KASH
Plasmid#207613PurposevDip-C AAV vector with mouse Pcp2 (also known as L7) promoter driving green fluorophore mGreenLantern with a KASH nuclear membrane tag to isolate cell nuclei of cerebellar Purkinje cellsDepositorInsertmGreenLantern
UseAAVTagsKASHExpressionMutationPromotermouse Pcp2 promoter (L7-6)Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mEGFP-Gphn_P1
Plasmid#194978PurposeAAV vector to drive the Flp-dependent expression of mEGFP (L221K) -Gphn (isoform P1) under the control of human Synapsin promoterDepositorInsertmEGFP-Gphn (isoform P1) (Gphn Synthetic, Rat)
UseAAVTagsmEGFPExpressionMutationPromoterAvailable sinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV mGAD65(delE1) GFP WPRE SV40pA
Plasmid#177316PurposeTo produce the AAV vector that expresses GFP under the control of the mGAD65 promoter. The mGAD65 promoter has highly specificity to GABAergic interneurons.DepositorInsertmGAD65(delE1) promoter, GABAergic interneurons specific promoter
UseAAVTagsExpressionMutationPromoterAvailable sinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEXFRT-ChR2(H134R)-mCherry
Plasmid#75470PurposeFlp-dependent Chr2-mCherry encoded in an AAV vector for rAAV production and expression in mammalian cellsDepositorHas ServiceAAV1InsertReversed ChR2(H134R)-mCherry
UseAAV and Synthetic BiologyTagsExpressionMammalianMutationPromoterCAGAvailable sinceJuly 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCAG eGFP T2A SP HALO HAPLN1
Plasmid#228200PurposeAAV vector expressing GFP and HaloTag-HAPLN1 under constitutive promoterDepositorInsertHAPLN1 (Hapln1 Mouse)
UseAAVTagsExpressionMammalianMutationPromoterconstitutive CAG promoterAvailable sinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TIWB-myrmScarlet-I-P2A-post-eGRASP
Plasmid#111584PurposeAn AAV vector that expresses myristoylated mScarlet-I and post-eGRASP linked by self-cleaving P2A peptide under the tetO promoter.DepositorInsertmyrmScarlet-I-P2A-post-eGRASP
UseAAVTagsExpressionMutationPromotertetOAvailable sinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TIWB-myrTagRFP-T-P2A-post-eGRASP
Plasmid#111590PurposeAn AAV vector that expresses myristoylated TagRFP-T and post-eGRASP linked by self-cleaving P2A peptide under the tetO promoter.DepositorInsertmyrTagRFP-T-P2A-post-eGRASP
UseAAVTagsExpressionMutationPromotertetOAvailable sinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hGFAP-Pink Flamindo-WPRE-SV40
Plasmid#178790PurposeAAV vector to express the red cAMP indicator in astrocytesDepositorInsertPink Flamindo
UseAAVTagsExpressionMutationPromoterhGFAPAvailable sinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pM124: pAAV-EFS-CasRx-VEGFA presgRNA
Plasmid#166872PurposeAAV vector for expressing CasRx and human VEGFA targeting presgRNA for RNA-editingDepositorInsertsU6-VEGFA presgRNA
RfxCas13d
UseAAV and CRISPRTagsHA and NLSExpressionMammalianMutationPromoterEFS and U6Available sinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FRT-myrSNAP-2A-H2BeGFP-WPRE
Plasmid#102986PurposeAAV expressing membrane-targeted SNAP protein and nuclear-targeted eGFP after FLP-mediated recombinationDepositorInsertsmembrane-targeted SNAP protein after FLP-mediated recombination
Nuclear-targeted eGFP after FLP-mediated recombination
UseAAV; Adeno associated viral vectorTagsExpressionMutationPromoterAvailable sinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CaMKII_NES-his-CaMPARI2-F391W-WPRE-SV40
Plasmid#163698PurposeAAV vector expressing CaMPARI2_F391W primarily in excitatory neurons in rodent cortexDepositorInsertCaMKII_NES-his-CaMPARI2-F391W-WPRE-SV40
UseAAVTagsFLAG-HA-myc and NES_hisExpressionMammalianMutationPromoterCaMKII fragmentAvailable sinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-NES-jRGECO1a-WPRE
Plasmid#216276PurposeAAV vector with hSynapsin promoter and DIO Lox sites for Cre-On expression of red fluorescent calcium indicator jRGECO1aDepositorInsertNES-jRGECO1a
UseAAV and Cre/LoxTags6XHIS and XpressExpressionMutationPromoterhuman synapsin 1 (hSyn)Available sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-Y-P2A-puro
Plasmid#192132PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-Y
UseAAVTagsExpressionMammalianMutationHsp1-Hsp2Cas9 (Y446A)PromoterAvailable sinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
AiP11390-pAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA (Alias: CN1390)
Plasmid#163505PurposeDLX2.0 (3xCore version of DLX enhancer). AAV vector for strong & rapid SYFP2 expression in forebrain GABAergic interneurons. The enhancer core has 100% seq conservation between mouse and humanHas ServiceAAV PHP.eBInsertSYFP2
UseAAVTagsExpressionMutationPromoterminBetaGlobinAvailable sinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP11839-pAAV-hSyn1-SYFP2-10aa-H2B-WPRE3-BGHpA (Alias: CN1839)
Plasmid#163509PurposeAAV vector for nuclear SYFP2 labeling in neurons. Useful for nuclear isolation and scRNA-seq applications.Has ServiceAAV PHP.eBInsertH2B-SYFP2
UseAAVTagsExpressionMutationPromoterhSyn1Available sinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {hCAR}off-{hM4Di-mCherry}on-W3SL
Plasmid#111397PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection), Cre-ON hM4Di-mCherry (Gi-coupled DREADD for neuronal silencing), W3SL cassette (for maximize cloning capacity)DepositorInsertsUseAAVTagsMyc and mCherryExpressionMammalianMutationPromoterhSynapsinAvailable sinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only