We narrowed to 1,500 results for: p53
-
Plasmid#16590DepositorAvailable SinceMay 14, 2008AvailabilityAcademic Institutions and Nonprofits only
-
N-Myc-53BP1 WT pLPC-Puro
Plasmid#19836DepositorAvailable SinceDec. 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
P55.SRE.mCMV.flag.mSrtA-3M.wpre
Plasmid#226774Purposesecretory SortaseA in p53 (SRE backbone)DepositorInsertsortase A (srtA )
ExpressionMammalianAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBABE-neo largeTcDNA delta434-444
Plasmid#8582DepositorInsertlarge T antigen (SV40gp6 simian virus)
UseRetroviralExpressionMammalianMutationdeletion in part of the bipartite p53 binding dom…Available SinceSept. 26, 2005AvailabilityAcademic Institutions and Nonprofits only -
mCherry-BP1-2 pLPC-Puro
Plasmid#19835DepositorInsertFragment of p53-Binding Protein 1 (TP53BP1 Human)
UseRetroviralTagsmCherryMutationFragment of human 53BP1 aa 1220 - 1711Available SinceNov. 21, 2008AvailabilityAcademic Institutions and Nonprofits only -
N-Myc-53BP1 D1521A pLPC-Puro
Plasmid#19837DepositorInsertp53 Binding Protein 1 (TP53BP1 Human)
UseRetroviralTagsMycMutationchanged Asp1521 to AlaAvailable SinceMarch 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAWH-largeT
Plasmid#133895PurposePositive control when used in combination with pBWH-p53. Negative control when used in combination with pBWH-Lam. Expression of Gal4AD-largeT hybrid protein. Homology regions for recombination with pBDepositorInsertLargeT
ExpressionYeastPromoterT7Available SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
miR-34aM53
Plasmid#50830Purposeluciferase reporter for human miR-34aDepositorInsertmiR-34A promoter M53 (MIR34A Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationp53 binding site mutated (-39)PromotermiR34aAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
MTK3b_027
Plasmid#123805PurposeEncodes human TP53 as a Type 3b part to be used in the MTK systemDepositorInsertp53
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
MLRV
Plasmid#118069PurposeMulti-luciferase reporter vector including transcriptional reporters for NF-kb, TGF-b, c-Myc, p53 and MAPK/JNK transcriptional reportersDepositorInsertsTB:5xNF-κβ:RedF:bGHpA
TB:4xTGF-β:FLuc:bGHpA
TB:5xE-box:Renilla:bGHpA
TB:2xp53:NLuc:bGHpA
TB:6xAP-1:GrRenilla:bGHpA
CMV:ELuc:bGHpA
UseLuciferase and Synthetic Biology; Assembly of gb2…ExpressionMammalianPromoter2xp53::miniP, 4xTGF-B::miniP, 5xEbox::miniP, 5xNF…Available SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-T2A-Puro_h53BP1_gRNA_D
Plasmid#110302PurposeExpresssion of Cas9-T2A-puromycin resistant gene and a gRNA targeting exon 10 of human 53BP1DepositorInsertp53-binding protein 1 (TP53BP1 Human)
ExpressionMammalianAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
p51.SRE.mCMV.CD63-GFP.wpre
Plasmid#226773PurposeCD63-GFP in p52 (SRE backbone)DepositorInsertCD63 (CD63 )
ExpressionMammalianAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Venus-Puma-pEGFP-C1
Plasmid#166739PurposeExpress Venus fused to the N-terminus of the Bcl-2 family protein, PumaDepositorAvailable SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Neo_h53BP1_gRNA_D
Plasmid#110300PurposeExpresssion of Cas9-T2A-neomycin resistant gene and a gRNA targeting exon 10 of human 53BP1DepositorInsertp53-binding protein 1 (TP53BP1 Human)
ExpressionMammalianAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 T21R-Nb139-T2A-mCherry
Plasmid#225589PurposeMammalian expression vector for TRIM21 RING-Nb139 anti-p53 degrader with a self-cleaving T2A-mCherry fluorescent expression reporterDepositorInsertT21R-Nb139-T2A-mCherry
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pShuttle-PR.Cre
Plasmid#192933PurposepShuttle.Cre encoding sgRNAs targeting Trp53 and Rb1 genesDepositorAvailable SinceDec. 9, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pShuttle-PR.CC9
Plasmid#192932PurposepShuttle.CC9 encoding sgRNAs targeting Trp53 and Rb1 genesDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShuttle-PRL.Cre
Plasmid#192934PurposepShuttle.Cre encoding sgRNAs targeting Trp53, Rb1 and Rbl2 genesDepositorAvailable SinceDec. 9, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits