We narrowed to 7,189 results for: cas9 plasmid
-
Plasmid#227291PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of CETN2 for knock-in.DepositorInsertsgRNA Targeting N-terminus of CETN2 (CETN2 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-H3C2
Plasmid#207780PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of H3C2 for knock-in.DepositorAvailable SinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEDJ-22
Plasmid#140904PurposeMarkerFree plasmid for integration of pADH1-PCP-Mxi1 into site X-4DepositorInsertPCP-Mxi1
PromoterADH1Available SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS143
Plasmid#122377PurposeCRISPRi plasmid for use in Candida albicans. Contains dCas9 and NEUT5L integration site and the sgRNA cloning site (SNR52 promoter, PacI sites, sgRNA tail)DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM765
Plasmid#133602PurposePart Plasmid for dCas9 NLS Stop, Part 3(coding sequence)DepositorInsertdCas9 NLS Stop
UseSynthetic BiologyAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM766
Plasmid#133603PurposePart Plasmid for dCas9 NLS Stop, Part 3b(coding sequence)DepositorInsertdCas9 NLS Stop
UseSynthetic BiologyAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-SpRY
Plasmid#161520PurposeGateway entry plasmid (attL1 & attR5) expressing 3_FLAG-NLS-zSpRYCas9-NLS without promoterDepositorInsertzSpRYCas9
UseCRISPR; Gateway compatible zsprycas9 entry cloneTags3X FLAG, NLS and NLSExpressionPlantAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-EGFP-KASH
Plasmid#154374PurposeVector for Flp-dependent expression of EGFP tagged KASH protein domainDepositorInsertEGFP-KASH
UseAAVExpressionMammalianAvailable SinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only