We narrowed to 7,185 results for: cas9 plasmid

#136060

G3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)

Anthony Leung

Fischer et al Mol Cell. 2020 Apr 2;78(1):70-84.e6. doi

April 24, 2020

Academic Institutions and Nonprofits only

#136061

G3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)

Anthony Leung

Fischer et al Mol Cell. 2020 Apr 2;78(1):70-84.e6. doi

Feb. 4, 2020

Academic Institutions and Nonprofits only

#163971

Trifunctional Cas9-VPR fusion protein plasmid for simultaneous transcriptional activation, transcriptional repression, and genome editing in yeast

Jiazhang Lian

Dong et al ACS Synth Biol. 2020 Sep 18;9(9):2252-22

Feb. 2, 2021

Academic Institutions and Nonprofits only

#232096

Yeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.

Jeffrey Lewis

Stuecker et al G3 (Bethesda). 2025 Aug 4:jkaf175. doi:

Jan. 30, 2025

Academic Institutions and Nonprofits only

#183883

pX459V2.0-HypaCas9 plasmid with H2BC11 sgRNA for C-terminal tagging of H2B histones in human cells.

Alisa Piekny

Husser et al Open Biol. 2022 Nov;12(11):220247. doi:

May 20, 2022

Academic Institutions and Nonprofits only

#183887

pX459V2.0-HypaCas9 plasmid with MYH10 sgRNA for N-terminal tagging of myosin heavy chain 10 in human cells.

Alisa Piekny

Husser et al Open Biol. 2022 Nov;12(11):220247. doi:

May 20, 2022

Academic Institutions and Nonprofits only

#234724

All-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9 expression in neurons. The plasmid lacks AAV2 ITR and f1 ori elements, enabling more efficient transfection and expression.

Kirill Martemyanov

Zhao et al Nat Commun. 2025 Apr 22;16(1):3768. doi:

April 22, 2025

Academic Institutions and Nonprofits only

#109311

Plasmid for AAV SaCas9 Mammalian Expression with a gRNA against Ldlr

William Lagor

Jarrett et al Arterioscler Thromb Vasc Biol. 2018 Jul

June 28, 2018

Academic Institutions and Nonprofits only

#121830

pMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) fused to the KRAB transcriptional repressor for 3 or 4-component MultiSite Gateway Pro assembly.

Christopher Newgard

Haldeman et al Nucleic Acids Res. 2018 Dec 27. pii: 526

June 27, 2019

Academic Institutions and Nonprofits only

#109315

Plasmid for liver-specific expression of AAV SaCas9 with a gRNA against Mttp

William Lagor

Li et al Mol Ther Methods Clin Dev. 2018 Dec 6;12

Jan. 31, 2019

Academic Institutions and Nonprofits only