We narrowed to 4,692 results for: Gca
-
Plasmid#238039PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp5
Plasmid#238038PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYAMTr2GCsgScLEU2
Plasmid#224868PurposeDisruption of S. cerevisiae type LEU2 geneDepositorAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
3xMS2 TR knockin sgRNA 1
Plasmid#207607PurposesgRNA for homology directed repair insertion of 3xMS2-TR-100-PURO into the endogenous TR locusDepositorInsertcgactcgcccggcagcgcac
TagsNoneExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Merry Target 3- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210743PurposeCoding for SaSp Cas9 alongside Merry sgRNA targeting GFP Target 3DepositorInsertsSaSp Cas9
Merry sgRNA GFP Target 3
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 4- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210748PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 4DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 4
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 2- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210746PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 2DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 2
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1- sgCTG Bilbo -eCMV-CjSpD8A-3XFLAG-SV40 NLS-ITR2
Plasmid#210749PurposeCoding for CjSp D8A alongside Bilbo sgRNA targeting CAG repeatsDepositorInsertsCjSp D8A Cas9
Bilbo sgCAG
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationD8A, N-terminal Cj Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 2- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210738PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 2DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianPromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 4- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210740PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 4DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianPromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
OA-1067L
Plasmid#200253PurposepBac-U6-gRNA(doublesex+Intersex+bTublin)-3xp3-tdTomatoDepositorInsert6 gRNAs targeting Doublesex, Intersex, bTublin
ExpressionInsectAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRPromotermouse U6Available SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Blimp1-L1-#1
Plasmid#171503Purposedeletion of a genomic locus in Blimp1(Prdm1) geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
E42_control_NGFR
Plasmid#189800PurposeRetroviral delivery of control guide RNADepositorInsertLuciferase gRNA
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056F
Plasmid#183134PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii tra, Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[tra]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_PSMB5
Plasmid#183317PurposeAll-in-One CRISPRko system with a guide RNA that targets PSMB5 geneDepositorInsertPSMB5
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_KDR
Plasmid#183305PurposeAll-in-One CRISPRko system with a guide RNA that targets KDR geneDepositorInsertKDR
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 GFP-Mpp2 KI
Plasmid#183434PurposeCreOFF knock-in for GFP-MPP2 (amino acid position: A4)DepositorInsertgRNA and GFP donor
UseCRISPRExpressionMammalianAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
1046E=dgRNAs[traB,bTub]
Plasmid#149425PurposeThe attB plasmid with the mini-white harboring two U6.3-gRNAs targeting Dmel tra and bTub genes.DepositorInsertU6.3-gRNAs[TraB, bTub]
UseCRISPRExpressionInsectPromoterU6.3Available SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDD2706
Plasmid#175080PurposeMammalian expression of Flag-tagged KSHV ORF45 RC mutantDepositorInsertKSHV ORF45 (ORF45 Kaposi's sarcoma-associated herpesvirus 8)
ExpressionMammalianMutationRC mutant; sequence mutation: GCGGCCGCAGCGCAAvailable SinceFeb. 8, 2022AvailabilityAcademic Institutions and Nonprofits only