We narrowed to 4,785 results for: pcr
-
Plasmid#221045PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsert3xFLAG epitopes
UseUnspecifiedPromoterread throughAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJS008
Plasmid#188331PurposePCR template for repair templates to tag a gene with a wrmScarlet and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertLinker::wrmScarlet::mIAA7
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJS011
Plasmid#188334PurposePCR template for repair templates to tag a gene with a mTagBFP2 and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertmIAA7::mTagBFP2::Linker
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJS006
Plasmid#188329PurposePCR template for repair templates to tag a gene with a mNeonGreen and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertLinker::mNeonGreen::mIAA7
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRKO
Plasmid#49456PurposeloxP-kanMX-loxP cassette inserted into the ACT1 intron for PCR amplification of the intron/kanMX module for one-step homology-driven genomic disruptionsDepositorInsertloxP-kanMX-loxP cassette
UseCre/LoxExpressionBacterialPromoternoneAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJJS005
Plasmid#188328PurposePCR template for repair templates to tag a gene with a mNeonGreen and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertmIAA7::mNeonGreen::Linker
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-puro-3Ty:tagRFPt:3Ty
Plasmid#201089PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInserttagRFPt
UseUnspecifiedPromoterread throughAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-tagRFPt
Plasmid#179790PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInserttagRFPt
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-TgKI-MCS-mScarlet-MCS-polyA
Plasmid#174023PurposeThis plasmid is used for generating C-terminal knock-in plasmid and/or PCR donors in zebrafish.DepositorInsertmScarlet
UseZebrafish knock-in taggingAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
LBJJ382
Plasmid#117518PurposeAlso known as LBJJ429. PCR template for sgRNA-EF with polyT, 67bp or 192bp terminatorDepositorInsertBpiI:ACTA:pU6-26:sgRNA-EF:t192bp:TTAC:BpiI
UseCRISPRExpressionPlantPromoterAtU6-26Available SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6.1-phleo-Ty:mNG:Ty
Plasmid#181936PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNG
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-3Ty
Plasmid#221047PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsert3xTy epitopes
UseUnspecifiedPromoterread throughAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-blast-His:mScarletI:His
Plasmid#201097PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmScarlet-I
UseUnspecifiedPromoterread throughAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCY 3090-06
Plasmid#36233DepositorInsertURA3
UseYeast cassette for pcr and homologous recombinati…TagsyEpolylinker-mCherry-URA3Available SinceAug. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTopo pLox hPGK-Puro pA pLox
Plasmid#171048PurposeEmpty donor template for CRISPR/Cas9 targeting of TERT RE'sDepositorTypeEmpty backboneUseCre/LoxExpressionMammalianAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-tdTomato
Plasmid#179794PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInserttdTomato
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJJS009
Plasmid#188332PurposePCR template for repair templates to tag a gene with a mKate2 and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertmIAA7::mKate2::Linker
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJS003
Plasmid#188326PurposePCR template for repair templates to tag a gene with a mCherry and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertmIAA7::mCherry::Linker
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-eGFP
Plasmid#179781PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInserteGFP
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only