We narrowed to 14,780 results for: sta
-
Plasmid#104433PurposeFor expressing gamma-tubulin in cells expressing γTUBULIN single guide RNADepositorInsertgamma-tubulin 1 (TUBG1 Human)
TagsNoneExpressionMammalianMutationchanged t bp28 to c; g bp30 to a; c bp33 to a; …Available sinceFeb. 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
hSTARR-seq_SULT1C vector
Plasmid#99294PurposeVector to measure enhancer activity of candidates from a DNA library by STARR-seq.DepositorTypeEmpty backboneUseHstarr-seq screening vectorExpressionMammalianAvailable sinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
hSTARR-seq_SCP1 vector_blocking 1
Plasmid#99316PurposeVector to measure enhancer activity of candidates from a DNA library by STARR-seq.DepositorTypeEmpty backboneUseHstarr-seq screening vectorExpressionMammalianAvailable sinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
hSTARR-seq_TTF2 vector
Plasmid#99293PurposeVector to measure enhancer activity of candidates from a DNA library by STARR-seq.DepositorTypeEmpty backboneUseHstarr-seq screening vectorExpressionMammalianAvailable sinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSTAP-seq_fly-ctrl
Plasmid#86380PurposeVector to measure the basal activity of CP candidates from a genomic library (cloned instead of the core promoter) by determining the abundance of transcripts originating from each candidate.DepositorTypeEmpty backboneUseStap-seq screening vectorAvailable sinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSTARR-seq_fly-pnr
Plasmid#71503PurposeflySTARR-seq screening vector with pnr core promoterDepositorTypeEmpty backboneUseFlystarr-seq screening vectorTagssgGFP (SuperGlo, Qbiogene, Inc)ExpressionInsectAvailable sinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSTARR-seq_fly-NipB
Plasmid#71502PurposeflySTARR-seq screening vector with NipB core promoterDepositorTypeEmpty backboneUseFlystarr-seq screening vectorTagssgGFP (SuperGlo, Qbiogene, Inc)ExpressionInsectAvailable sinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGST1-STAM1-UIM
Plasmid#44425DepositorAvailable sinceJuly 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-STAG2-D299A
Plasmid#31975DepositorInserthuman STAG2 cDNA (STAG2 Human)
TagsEGFP and FLAGExpressionMammalianMutationchanged Aspartic acid 299 to AlanineAvailable sinceAug. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGSTag BimEL (T112A)
Plasmid#23101DepositorInsertBim EL (TA) (Bcl2l11 Mouse)
TagsGstExpressionBacterialMutationChanged Threonine 112 to AlanineAvailable sinceFeb. 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGSTag BimEL (T112D)
Plasmid#23102DepositorInsertBim EL (TD) (Bcl2l11 Mouse)
TagsGstExpressionBacterialMutationChanged Threonine 112 to AspartateAvailable sinceFeb. 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pHIS2-hsSTAM1 (1-143)
Plasmid#21498DepositorPublicationAvailable sinceSept. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEM237 - pEXP[Prpl-3 | histamine | rpl-3 UTR]
Plasmid#159796PurposeHistamine based negative selection marker to paralyze animals with arraysDepositorInsertpEXP[Prpl-3 | histamine | rpl-3 UTR]
ExpressionWormMutationNot applicableAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
siRNA-resistant pLV-SigmaR1-mNeonGreen
Plasmid#226569PurposeEncodes siRNA resistant SigmaR1 protein labeled with mNeonGreen (lentiviral vector)DepositorAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-MBP-HsStaufen1-T2_V
Plasmid#147743PurposeMammalian Expression of HsStaufen1-T2DepositorInsertHsStaufen1-T2 (STAU1 Human)
ExpressionMammalianAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-MBP-HsStaufen1-T3_V
Plasmid#147744PurposeMammalian Expression of HsStaufen1-T3DepositorInsertHsStaufen1-T3 (STAU1 Human)
ExpressionMammalianAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAD-CMV-STAT5A-DN-CMV-GFP
Plasmid#83252PurposeAdenoviral expression of STAT5A dominant negative with co-expression of GFPDepositorInsertsUseAdenoviralMutationC-terminal deletion of 135 nucleotides (dominant …PromoterCMVAvailable sinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_mP_SV40
Plasmid#99310PurposeLuciferase validation vector with SV40 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertSV40 enhancer
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable sinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_SCP1_CMV
Plasmid#99314PurposeLuciferase validation vector with CMV enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertCMV enhancer
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable sinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only