We narrowed to 8,876 results for: sgrna
-
Plasmid#104441PurposeProvide and shuffle a cassette of AtU6:sgRNA-transRNA into SM-destination vectors (pRW006 and pRW004) with golden gate cloning strategy. Work together with pEF004.DepositorInsertsgRNA-transRNA transcription by U6 promoter
UseCRISPRExpressionBacterial and PlantAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF004-sgRNA-shuffle-in
Plasmid#104440PurposeProvide and shuffle a cassette of AtU6:sgRNA-transRNA into SM-destination vectors (pRW006 and pRW004) with golden gate cloning strategy. Work together with pEF005DepositorInsertsgRNA-transRNA transcription by U6 promoter
UseCRISPRExpressionBacterial and PlantPromoterU6 promoterAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMA-MsgRNA-EGFP
Plasmid#80794PurposeFor insertion of gRNA array containing 11-30 gRNA modulesDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-ACTB_sgRNA
Plasmid#183885PurposepX459V2.0-HypaCas9 plasmid with ACTB sgRNA for N-terminal tagging of beta-actin in human cells.DepositorAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShoCAST-sgRNA_entry (BO1)
Plasmid#181786PurposeExpresses ShoCAST. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialPromoterLac and J23119Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShoHELIX-sgRNA_entry (BO3)
Plasmid#181784PurposeExpresses ShoHELIX containing a nicking I-AniI fusion to ShoTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTK73.ChrII_ttTi5605.sgRNA
Plasmid#194058PurposesgRNA targeting ChrII_ttTi5605 locus of the C. elegans genomeDepositorInsertChrII_ttTi5605 sgRNA
ExpressionWormPromoterU6Available SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
px330-UFM1 sgRNA2
Plasmid#134634Purposecontains sgRNA targeting human UFM1 for gene knockoutDepositorInsertUFM1 sgRNA2 (UFM1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-UFM1 sgRNA1
Plasmid#134633Purposecontains sgRNA targeting human UFM1 for gene knockoutDepositorInsertUFM1 sgRNA1 (UFM1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only