We narrowed to 3,240 results for: Streptococcus
-
Plasmid#177345PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from Synapsin promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterSynapsinAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AV15_pCAG.Cas9.gRNA.S1
Plasmid#199259PurposeExpression construct encoding SpCas9 nuclease and an AAVS1-targeting guide RNADepositorInsertsSpCas9 nuclease
AAVS1-targeting gRNA
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterCAG promoter and RNA polymerase III promoter for …Available sinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV8-cPE-N
Plasmid#183538PurposeDeliver a split compact Prime Editor in vivoDepositorInsertN-terminal fragment of SpCas9 nickase (H840A)
UseAAVExpressionMammalianAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PX398 Nitratifractor salsuginis str DSM 16511 Cas9
Plasmid#68334PurposeNitratifractor salsuginis str DSM 16511 Cas9DepositorInsertNsCas9
UseCRISPRTagsHA and NLSExpressionMammalianPromoterCMVAvailable sinceAug. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKM126
Plasmid#105134PurposeClostridium difficile CRISPR-cas9 mutagenesis plasmid Tn916 oriTDepositorInsertsUpstream & Downstream pyrE deletion region
tetR
Cas9
gRNA
UseE. coli - c. difficile shuttle vectorAvailable sinceJan. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
L-CRISPR-CTN (MLL-ctrl)
Plasmid#69215PurposeAdvanced lentiviral CRISPR-Cas9 vector for induction of chromosomal translocations; control, MLL-sgRNA + luciferase-sgRNADepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV promoter
P2A-mNeonGreen
UseCRISPR and LentiviralTagsFLAGAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAEL003877-Cas9
Plasmid#100581PurposeThe promoter of AAEL003877 drive expression of Streptococcus pyogenes Cas9 gene in Aedes aegyptiDepositorInsertsAAEL003877-hspcas9-GFP
Opie-dsRed
UseCRISPRTagsGFP and dsREDExpressionInsectPromoterAAEL003877 and Opie2Available sinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMB109
Plasmid#223017PurposeCas9 and Csy4 with 5' and 3' targets (II) for Lotus callus assayDepositorInsertCas9 and Csy4 with 5' and 3' targets (II)
UseCRISPRExpressionPlantAvailable sinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMB105
Plasmid#223016PurposeCas9 and Csy4 with 5' and 3' targets (I) for Nicotiana leaf assayDepositorInsertCas9 and Csy4 with 5' and 3' targets (I)
UseCRISPRExpressionPlantAvailable sinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; T2_gRNA
Plasmid#197647PurposepDEL160; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type II sgRNADepositorInsertszCREST3
Cas9
nrg1 type II sgRNA
UseTol2 destination vectorAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; T1_gRNA
Plasmid#199332PurposepDEL159; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type I sgRNADepositorInsertszCREST3
Cas9
nrg1 type I sgRNA
UseTol2 destination vectorAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVH321-2-Tier1-PhCMV-NLS-dCas9-3xNLS
Plasmid#169596PurposeTier-1 vector encoding PhCMV-driven NLS-dCas9-3xNLS expression (PhCMV-NLS-dCas9-3xNLS-pA).DepositorInsertdead S.pyogenes Cas9
ExpressionMammalianPromoterPhCMVAvailable sinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH321-1-Tier1-PhCMV-dCas9-3xNLS
Plasmid#169595PurposeTier-1 vector encoding PhCMV-driven dCas9-3xNLS expression (PhCMV-dCas9-3xNLS-pA).DepositorInsertdead S.pyogenes Cas9
ExpressionMammalianPromoterPhCMVAvailable sinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCF704
Plasmid#121658PurposeU6-sgRNA EFS-ProCas9-Flavi-P2A-PuroDepositorInsertCas9(C)
UseLentiviralPromoterU6Available sinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCF712
Plasmid#121663PurposeU6-sgRNA EF1a-ProCas9-Flavi-P2A-PuroDepositorInsertCas9(C)
UseLentiviralPromoterU6Available sinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-HFSpCas9-H840A
Plasmid#80455Purposehigh fidelity SpCas9 mammalian expression vectorDepositorInsertHFSpCas9_H840A
UseCRISPRTags3xFLAG and NLSExpressionMammalianPromoterCBhAvailable sinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_cpaA
Plasmid#133344Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets cpaA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_cpaA
UseCRISPRPromoterconstitutiveAvailable sinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIF1079
Plasmid#237445PurposeExpression SpCas9 and Efe1-RT from bidirectional CAG promoters. SpCas9 sgRNA and Efe1 non-coding expression is driven by U6 and H1 respecitvely.DepositorInsertsSpCas9
Efe1-RT
EMX1 sgRNA
Efe1-ncRNA targeting EMX1
Tags3xFLAGExpressionMammalianPromoterCAG, H1, and U6Available sinceJune 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTK-DN1
Plasmid#180282PurposeCas9 cassette (TU1)DepositorInsertConLS - pPGK1 - Cas9 - tPGK1 - ConR1
ExpressionBacterialPromoterpPGK1Available sinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only