We narrowed to 1,236 results for: vector/1000
-
Plasmid#178162PurposeDonor vector for endogenous tagging of human KCND3 at the C-terminus with halotagInsertHalotag (KCND3 Human)
UseDonor vectorAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
APP_Halo_C_allele
Plasmid#178137PurposeDonor vector for endogenous tagging of human APP at the C-terminus with halotagInsertHalotag (APP Human)
UseDonor vectorAvailable SinceDec. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pB6-Cdk6-T2A-TagRFPT-dre-PBD*-FNF-TK
Plasmid#141452PurposeB6J Cdk6-T2A-TagRFPT-dre-PBD* allele targeting vector, low copy numberDepositorInsertCdk6 (Cdk6 Mouse)
UseMouse Targeting; Dre / roxTagsC-terminal fusion of T2A-TagRFPT-dre-PBD*ExpressionMammalianAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-neo (1795)
Plasmid#41000DepositorTypeEmpty backboneExpressionMammalianPromoterCMVAvailable SinceNov. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
pUCHR-inLuc
Plasmid#58955PurposeHIV-1 transfer vector, encodes firefly luciferase gene interrupted by a gamma-globin intron. The reporter gene is silent in the transfected cells and expressed in the infected cells.DepositorInsertinLuc
UseLentiviralPromoterCMVAvailable SinceSept. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCRU5HT1-inLuc
Plasmid#58954PurposeHTLV-1 transfer vector that encodes firefly luciferase gene interrupted by a gamma-globin intron. The reporter gene is transduced only after the completion of viral cycle replication.DepositorInsertinLuc
UseRetroviralPromoterCMV/R/U5Available SinceSept. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-olig1
Plasmid#192744PurposeGateway entry vector encoding zebrafish olig1DepositorAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-sCAG-eGFP-RAB11
Plasmid#203799PurposeAAV vector plasmid expressing human RAB11 fused to eGFP under a short variant of the CAG (sCAG) promoterDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN-TdTomato-RAB11
Plasmid#203732PurposeAAV vector plasmid expressing human RAB11 fused to TdTomato under the human synapsin (SYN) promoterDepositorInsertRAB11 (RAB11A Human)
UseAAVTagsTdTomatoExpressionMammalianPromoterHuman synapsin promoterAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN-eGFP-RAB11
Plasmid#203731PurposeAAV vector plasmid expressing human RAB11 fused to eGFP under the human synapsin (SYN) promoterDepositorAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR-L5-Kir2.1-mCherry-L2
Plasmid#32669DepositorInsertKir2.1-mCherry (Kcnj2 Mouse)
UseGateway cloning vectorAvailable SinceMarch 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-nrip1b
Plasmid#192732PurposeGateway entry vector encoding zebrafish nrip1bDepositorInsertnrip1b (nrip1b Zebrafish)
UseGateway entry vectorMutationL661P (rs511527097); S720P; A801T; K862E; A863P; …PromoterNoneAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
pDONR221-dyrk1aa
Plasmid#192741PurposeGateway entry vector encoding zebrafish dyrk1aaDepositorAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj6
Plasmid#192725PurposeGateway entry vector encoding zebrafish kcnj6DepositorInsertkcnj6 (kcnj6 Zebrafish)
UseGateway entry vectorMutation5' insertion of ATGGCCAAGCTGACAGAATCC, ident…PromoterNoneAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR223 Rab11A WT-STOP
Plasmid#228030PurposeDONR vector for shuttling Rab11A WT into DEST vector. Contains a STOP codon.DepositorInsertRab11A (RAB11A Human)
UseGateway donrAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CALU-WPRE-UbC-mCherry
Plasmid#225952PurposeLentiviral vector plasmid expressing human calumenin (CALU) under the spleen focus-forming virus (SFFV) promoter and mCherry under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBigTB
Plasmid#149432Purposeshuttle vector with blasticidin-S resistance into ROSA26 targetting vectorsDepositorTypeEmpty backboneUseCre/Lox and Mouse TargetingExpressionMammalianPromoterSV40Available SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only